Five South Western province of the country, where prevailing different pedo-climatic conditions, were used for this study. The province of Katanga and Kasaï—Oriental; with a tropical climate type Aw6 according to Köppen climate classification—Were average daily temperature varies between 19˚C and 20˚C, the average annual rainfall is 1.226 mm. The floor of Katanga, in places, three different geological types. The soils of Kasaï Oriental province belong to the order of Kaolisols [19] . Bandundu, Bas-Congo and Kinshasa urban and peri-urban, most of which is located in the natural setting of the central basin, have two types of climatic zones: the tropical climate on the one hand and the other part equatorial climate. The daily temperature is 25˚C with very little variation; average annual rainfall amounts to 1500 mm. the soil of three provinces are extremely diverse.

Epidemiological surveys were conducted in farmer’s fields over a 2 years period in Bas-Congo and Kinshasa urban and peri-urban areas, in Katanga, Kasaï—Oriental and Bandundu. A total of 72 sites were surveyed (Figure 1) 6 sites in Katanga, 16 sites in Kasaï—Oriental, 11 sites in Kinshasa urban and peri - urban areas, 16 sites in Bas Congo and 23 sites in Bandundu. In each site three farmers’ fields were randomly selected (Table 1).

Using a questionnaire designed for this purpose, the producer responsible for the field was individually interviewed.

A result of the interviews with the producer, the banana leaf samples with typical symptoms and asymptomatic were collected. Banana leaf samples were stored in tubes as Bas samples, containing over anhydrous calcium chloride (Cacl2).

The total DNA was extracted from 100 mg of leaf samples by the method described by Dellaporta [20] . Banana bunchy top virus detection was performed by polymerase chain reaction using the primer pair BBTV1f/BBTV1r (GCGTGAAACGCACAAAAGGCC and GCATACGTTGTCAAACCTTCTCCTC) designed to amplify a 240 bp product corresponding to the care region of DNA-R. An initial cycle of denaturation at 95˚C for 10 minutes followed by 34 cycles of (95˚C for 30 sec, 55˚C for 45 sec, 72˚C for 30 sec) and the finally extension at 72˚C for 10 minutes [10] .

The frequency or incidence of Banana bunchy top virus in each province was calculated by establishing the ration between the total number of positive samples and the total number of samples tested, multiplied by 100.

For each field surveys, agro-ecological characteristics were taken into account. These include the production system in which the banana growing, genotype, cultivar type, source of planting material, monitoring the health status before planting, the type of fertilization, the number of fertilization banana during the complete cycle of the plant, the type of maintenance, treatment plant, intercropping system, altitude and crop age.

At the end of the investigations on the agro- ecological factors, the survey questionnaires were stripped and proportion of each parameter were calculated by comparing the number of observed parameter on the total number of fields investigated in the province. The logiciel R was used to analyze parameters, the standard deviation was calculated, the variance and the correlation between different parameters were established.

This analysis has allowed to evaluate each parameter and highlights the major constraints that effect banana cultivation in DRC.

A total of 174 symptomatic and asymptomatic samples, collected from five provinces of South Western democratic republic of Congo. The result revealed that 77 samples, or 44.8% of the plantations surveyed, analyzed were positive to Banana bunchy top virus (Figure 2).

The expected BBTV DNA fragment of 240bp was amplified from leaf tissue samples (Appendix Figure 1 & 2).

In the five provinces concerned by this study, Banana bunchy top virus was present in every type of cropping system (Figures 2 & 3). In farmer’s field, plantation, experimental station, both in forest and savannah area (Figure 2). BBTV also detected in all type of banana (Cooking and dessert).

Results indicate that the level of prevalence of BBTV is variable in each province. Five provinces studied, the highest frequency of BBTV was observed in the Bas-Congo province (17.8%) (X² = 69.27; ddl = 4; p = 0) and lowest frequency was observed in the Katanga province (1.1%). In between Kasai-oriental (12.1%) and Kinshasa urban and pre-urban (7.5%) and Bandundu has an infection rate of 6.3% recorded middle range prevalence (Figure 3).

To understand distribution of BBTV, agro-ecological characteristics of the sites surveyed were also studied; the results are shown in Table 1.

· Planting material quality origin and varieties

Banana and plantain are vegetatively propagated plant. The crop thus requires the use of certified and healthy planting material. Results of this investigation indicate that planting materials used in both experimental station, and in farmer’s field are not always healthy and certified.

· Origin and varieties

Planting materials was of unknown healthy status in 100% of cases. The varieties used in research station and farmer’s field are local varieties, from previous culture and frequently of unknown origin (Table 1). However, local varieties used in research centre originate from their collection. In the five provinces surveyed, the frequency of cooking banana and banana dessert proved variable. Cooking banana is predominant in Kasaï Oriental and Bas Congo (71.9% and 62.5%) banana dessert is predominant in Bandundu, Katanga and Kinshasa urban and peri-urban (frequency of 67.2%; 83.3%; 57.1%). Banana grown for beer has not been surveyed in the selected sites.

· Cropping system, fertilization and use of fertilizers in banana cultivation

The survey of 72 sites in five provinces of the South Western of the country indicate that the banana and plantain are grown mostly in the cropping system of plantations around dwelling, where fertilization is mostly organic with a low frequency of fertilization. Most of the time, the supply of organic fertilizer is done before planting. This observation was performed in all types of cropping system.

In Katanga and Kinshasa urban and peri-urban, in respectively 50% and 57.1% of cases, the banana is fertilized at planting and during the cycle. The regular intake of leaves and waste are carried out (Table 1).

The plant remains longer in the same place without renewed strain.

The age of the plantation is usually more than 12 months, and interviews are not made or if they are made they are limited to weeding-ridging (25.9% Bandundu, Kinshasa urban and peri-urban 21.4%, Bas Congo, 12.5%). The banana adapts in a moist environment at high humidity greater than 60%, with deep, loamy, well-drained pH between 4.0 and 8.0.

Nitrogen, phosphorus and potassium are major elements essential to the growth of the banana. The Ca and Mg are also needed to culture [21] . Aside from soils mountainous regions of the country, the Congolese soils are mostly lateritic, leached, acid and poor. The conclusions of the work of Dowiya [22] have shown that, in Eastern Democratic Republic of Congo, soil fertility was not a constraint for banana cultivation. In South west, the soil is limiting factor that need special attention. Culture of banana made without the input of mineral fertilizer or organic in the cycle of the plant, rapidly degrades soil quality and yield reduction was observed consecutively. This partly explains the existence of extensive cultivation among farmers.

Productivity of the banana depends on natural conditions controlled or mastered by the best facilities, cultivation techniques, pesticides treatments etc. [9] .

· Use of chemical treatment

Results of the investigations presented in Table 1 shows that 100% of farmers do not use chemical pesticides despite the high pest pressure. Only experimental stations in Katanga province use fungicides for control of foliar pests. Management of pests and diseases of banana implies the short-term use of chemical pesticides with significant environmental risks. The lack of chemical pesticides and non-pesticide use inhibit the growth of production and therefore discourages intensification of banana cultivation. This result suggest that a sustainable alternatives and/ or effective would be the development of rational strategies of disease management, the definition of good agricultural practices necessary to reduce pest pressure. The search for varieties resistant to these diseases and the development of biological control methods suitable and more efficient are way to sustainable disease control.

· Care cropping

Banana cultivation is carried out in bulk without additional crop tending. In the study area, Bandundu, Katanga, Kasaï Oriental, Kinshasa urban and peri-urban, bas Congo, bananas do not receive any cultural care, respectively in 74.1% of cases, 100%, 100%, 78.6% and 87.5%. In the remaining cases, in the province of Bandundu, Kinshasa urban and peri urban, bas Congo, the banana is just weeded, stumbled and staked to prevent the fall of the plant, related to the wind.