<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2019.1011029</article-id><article-id pub-id-type="publisher-id">ABB-96517</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Resveratrol Attenuates Benzo(a)pyrene-Induced Dysfunctions, Oxidative Stress and Apoptosis in Pancreatic Beta-Cells
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sefa</surname><given-names>Çelik</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Bariş</surname><given-names>Baysal</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Serkan</surname><given-names>Şen</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Atatürk Vocational School of Health Services, Afyonkarahisar Health Sciences University, Afyonkarahisar, Turkey</addr-line></aff><aff id="aff1"><addr-line>Department of Medical Biochemistry, Faculty of Medicine, Afyonkarahisar Health Sciences University, Afyonkarahisar, Turkey</addr-line></aff><pub-date pub-type="epub"><day>06</day><month>11</month><year>2019</year></pub-date><volume>10</volume><issue>11</issue><fpage>389</fpage><lpage>404</lpage><history><date date-type="received"><day>5,</day>	<month>October</month>	<year>2019</year></date><date date-type="rev-recd"><day>18,</day>	<month>November</month>	<year>2019</year>	</date><date date-type="accepted"><day>21,</day>	<month>November</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
   
   Background: Diabetes mellitus is one of the major health problems for people all over the world today. According to international diabetes federation reports, diabetes affects 382 million people worldwide. Environmental pollutants have deleterious effects on glucose metabolism and cause insulin resistance. We aimed to investigate the effects of the environmental pollutants benzo(a)pyrene, and the therapeutic potential of resveratrol. Methods: 20 μM of benzo(a)pyrene was administered after 48 h of resveratrol (80 μM) application for 24 h in INS-1 (832/13) insulinoma cells. The cells were treated with 20 μM benzo(a)pyrene for 24 hours after 48 hours initial preconditions with 10 μM resveratrol. Oxidative stress status, insulin secretion and apoptosis were analyzed by molecular techniques. Results: Though resveratrol increased the antioxidant status which was decreased by benzo(a)pyrene, interestingly, it increased the oxidative status. Resveratrol increased benzo(a)pyrene-depleted reduced glutathione levels to the control level. The mRNA expression levels of beta-cell functions associated with genes insulin-1, insulin-2 and sirtuin-1 were upregulated by resveratrol. Resveratrol treatment elevated the insulin concentration of culture medium, and the mRNA expression of forkhead box protein-1 gene. Resveratrol upregulated benzo(a)pyrene-downregulated p53 gene expression. On the other hand, benzo(a)pyrene-downregulated mRNA expression of B-cell lymphoma-2 was induced by resveratrol treatment. Conclusion: The data showed that resveratrol could reverse the oxidative alterations, functional impairments and the carcinogenetic effects of benzo(a)pyrene in pancreas beta-cells. 
  
 
</p></abstract><kwd-group><kwd>Benzo(a)pyrene</kwd><kwd> INS-1 (832/13) Insulinoma Cell</kwd><kwd> Insulin</kwd><kwd> Apoptosis</kwd><kwd> Oxidative Stress</kwd><kwd> Resveratrol</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Diabetes mellitus (DM) is characterized by exclusively or partially deficiency of insulin released from the pancreas. Type 2 DM (T2DM) is closely related with insulin resistance and is life threatening as significant public health problem in adults, children and adolescents [<xref ref-type="bibr" rid="scirp.96517-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref3">3</xref>]. Diabetes ranks seventh in the causes of death. In the early stages of T2DM, the beta cells produce excessive amounts of insulin to ensure the continuation of normal blood glucose levels. However, beta cells can not cope with mitochondrial dysfunction, resulting in endoplasmic reticulum stress and apoptosis [<xref ref-type="bibr" rid="scirp.96517-ref4">4</xref>]. Consequently, a reduction occurs in the beta cell mass [<xref ref-type="bibr" rid="scirp.96517-ref5">5</xref>].</p><p>The oxidative stress may develop due to the production of reactive oxygen species (ROS) in high levels and/or lack of antioxidant defense system [<xref ref-type="bibr" rid="scirp.96517-ref6">6</xref>]. The activities of antioxidant enzymes are increased in diabetes. It is thought that increases of hydrogen peroxide and superoxide by the events including non-enzymatic glycosylation and auto-oxidation of glucose are the basis of this phenomenon [<xref ref-type="bibr" rid="scirp.96517-ref7">7</xref>]. Significant decreases in plasma reduced glutathione (GSH) levels occur in diabetes [<xref ref-type="bibr" rid="scirp.96517-ref8">8</xref>]. The GSH is the most important bio-molecule in defense against chemicals. It also acts as a free radical scavenger and can repair cell damage caused by radicals [<xref ref-type="bibr" rid="scirp.96517-ref9">9</xref>].</p><p>The essential factors for the progression of the T2DM are obesity and insulin resistance. However, this results in inadequate insulin secretion from beta cells to compensate for insulin deficiency. In either case, it is regarded as the main pathway of the beta cell death, apoptosis. There are many potentially effective stimulants in the apoptosis of the beta cell. These are Fas ligand and Fas receptors as death receptors, perforins, cytokines [<xref ref-type="bibr" rid="scirp.96517-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref11">11</xref>], ROS [<xref ref-type="bibr" rid="scirp.96517-ref12">12</xref>], reactive nitrogen species [<xref ref-type="bibr" rid="scirp.96517-ref13">13</xref>], alkylating agents [<xref ref-type="bibr" rid="scirp.96517-ref14">14</xref>], ceramide [<xref ref-type="bibr" rid="scirp.96517-ref15">15</xref>]; lack of growth factors [<xref ref-type="bibr" rid="scirp.96517-ref16">16</xref>].</p><p>It has been hypothesized by Longnecker and Daniels [<xref ref-type="bibr" rid="scirp.96517-ref17">17</xref>] that chemical contaminants may play an important role in the etiology of T2DM. This hypothesis was supported by epidemiological studies; this is an indication that the increase in insulin resistance or incidence of T2DM is a consequence of exposure to high levels of arsenic, organochlorine contaminants and air pollution [<xref ref-type="bibr" rid="scirp.96517-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref21">21</xref>].<sup> </sup></p><p>Pollution has harmfull effects on human health directly. Approximately 40% of human deaths in the world depend on environmental pollution. Even people who have never smoked in their lifetime are suffering from respiratory diseases such as lung cancer due to air pollution. Polluted waters cause many diseases. More than 1.2 million people in the world cannot find clean water for their lives. Contaminated soil carries chemicals and numerous toxins. Benzo(a)pyrene [B(a)P] is a compound with a pentacyclic polycyclic aromatic hydrocarbon structure. The most important source of atmospheric B(a)P is wood burning. It is also found in coal tar, in automobile exhaust fumes (especially in diesel engines) and in all fumes from organic materials and grilled food burning [<xref ref-type="bibr" rid="scirp.96517-ref22">22</xref>]. The metabolites of B(a)P are carcinogenic and cause DNA degradation. For example, Benzo(a)pyran-8-diol-9,10-epoxide forms further DNA products [<xref ref-type="bibr" rid="scirp.96517-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref24">24</xref>].</p><p>Resveratrol (RES) is a natural phytoalex produced by many fruits and plants, including grapes. It prevents DNA damage and lipid peroxidation in cell membranes. Various research studies [<xref ref-type="bibr" rid="scirp.96517-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref27">27</xref>] have indicated that it is necessary to carry out further studies on how RES can be used in cancer treatment. Resveratrol activates sirtuin (Sirt)-1 [<xref ref-type="bibr" rid="scirp.96517-ref28">28</xref>] which plays an important role in many different physiological events such as cell cycle regulation, metabolism and inflammation [<xref ref-type="bibr" rid="scirp.96517-ref29">29</xref>]. Previous studies have demonstrated that Sirt-1 has a positive regulatory role in insulin secretion and the persistence of beta cell function [<xref ref-type="bibr" rid="scirp.96517-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref32">32</xref>].</p><p>However, to our knowledge, there is no previous report on the direct effect of environmental pollutant B(a)P on insulin levels produced by pancreatic beta cells. Therefore, the present study was designed to evaluate the possible effects of RES on oxidative stress, diysfunction and apoptosis in the pancreatic beta cells exposed to B(a)P in vitro.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>All chemicals except resveratrol (Cayman Chemical, Tallin, Estonia) were purchased from Sigma-Aldrich (Germany). INS1-E pancreatic cell line was obtained from Lisa Poppe (Duke University Medical Center, USA).</p></sec><sec id="s2_2"><title>2.2. Cell Culture and Treatments</title><p>Rat panceatic INS-1 (832/13) cell line was cultured in RPMI 1640 supplemented with 10% FBS, 100 units/ml penicillin and 100 &#181;g/ml streptomycin, 1 mM sodium pyruvate, 5 mM glutamine, 50 &#181;M 2-mercaptoethanol and 10 mM HEPES buffer. Cells were incubated at 37˚C in a humidified atmosphere (95% air, 5% CO<sub>2</sub>). INS-1 cells were seeded at a density of 2.1 &#215; 10<sup>6</sup> cells/ml in a 75-cm<sup>2</sup> culture flask and grown for 2 - 3 days before use.</p></sec><sec id="s2_3"><title>2.3. Experimental Groups</title><p>INS-1 β-cells were divided into four groups: control group, resveratrol administrated group, benzo(a)pyrene treated group, and benzo(a)pyrene treated followed by resveratrol administrated group. Resveratrol was administered in an amount of 10 &#181;M for 48 h in RES and RES + B(a)P goups [<xref ref-type="bibr" rid="scirp.96517-ref33">33</xref>]. After first incubation, 20 &#181;M B(a)P [<xref ref-type="bibr" rid="scirp.96517-ref34">34</xref>] was added into the flasks in B(a)P and RES + B(a)P groups, and this second incubation was carried out for 24 h. After last incubation, the cells were separated from medium and used for biochemical analysis. Each assay was performed in triplicate and repeated three times.</p></sec><sec id="s2_4"><title>2.4. Protein Analysis</title><p>The medium was removed, and the cells were harvested by trypsin-EDTA treatment and washed twice with PBS. The harvested cells were lysed in lysis buffer. The lysates were centrifuged at 12.000 g (4˚C, 10 min). The protein concentrations were determined in supernatants by Bradford method [<xref ref-type="bibr" rid="scirp.96517-ref35">35</xref>].</p></sec><sec id="s2_5"><title>2.5. Glucose Stimulated Insulin Secretion Analysis</title><p>After incubating with resveratrol and B(a)P, the cells were washed in Krebs-Ringer bicarbonate (KRB) solution containing 2.8 mM glucose for 1 h, with subsequent incubation in KRB solution, containing 2.8 mM glucose for 30 min at 37˚C. At the end of the experiment, secreted insulin levels were quantified in the medium samples by the Rat/Mouse Insulin ELISA kit (EZRMI-13K, Merck Millipore, Merck Darmstadt, Germany).</p></sec><sec id="s2_6"><title>2.6. Measurements for Oxidative Stress-Related Parameters</title><p>The total antioxidant status (TAS) of the cell lysate was determined by the test kit from Rel Assay Diagnostics (Gaziantep, Turkey). This colorimetric method based on the bleaching of color characteristics of a more stable ABTS [2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] radical cation by antioxidants [<xref ref-type="bibr" rid="scirp.96517-ref36">36</xref>]. <sup> </sup></p><p>The total oxidant status (TOS) levels were determined by the test kit from Rel Assay Diagnostics (Gaziantep, Turkey) using a novel automated method, which was developed by Erel [<xref ref-type="bibr" rid="scirp.96517-ref37">37</xref>], in the cell lysates. In this method, oxidants presented in the sample oxidized the ferrous ion-o-dianisidine complex to ferric ion. The ferric ion produced a colored complex with xylenol orange in an acidic medium. The color intensity was measured spectrophotometrically at 530 nm wavelength. The results were calibrated with hydrogen peroxide and expressed as &#181;mol H<sub>2</sub>O<sub>2</sub> equiv./mg prot).<sup> </sup></p><p>The Oxidative Stress Index (OSI), which is an indicator of the degree of oxidative stress, was calculated according to the formula: OSI = TOS (μmol/mg prot)/(TAS (mmolTroloxEquiv/L) &#215; 100 [<xref ref-type="bibr" rid="scirp.96517-ref38">38</xref>].</p><p>The Griess reaction was used for determining the NO levels in the cell lysates [<xref ref-type="bibr" rid="scirp.96517-ref39">39</xref>]. The results were expressed as μmol/mg protein.</p><p>The GSH level of samples was determined by spectrophotometer at 412 nm after the reaction between sulfhydryl groups present in supernatant and DTNB (5,5’-2-dithiobis nitrobenzoic acid) [<xref ref-type="bibr" rid="scirp.96517-ref40">40</xref>]. The results of the analysis were expressed as μmol/mg protein.</p></sec><sec id="s2_7"><title>2.7. Total RNA Isolation and Real Time PCR Analysis</title><p>The cells were seeded in 25-cm<sup>2</sup> culture flasks and grown for 1 - 2 days before use. Cells were collected and washed with PBS after completion of incubations given above. Total RNA was isolated by RNAeasy kit according to manufacturer’s instructions (Qiagen, Valencia, CA). cDNA was generated with a First Strand cDNA Synthesis kit according to manufacturer’s instructions (Thermo Scientific, Waltham, MA USA). Briefly, 1 μg of total RNA was used as template in RT reaction, which was carried out with RevertAidTM H(-) M-MuLV Reverse Transcriptase (MBI Fermentas) following instructions provided by the manufacturers. RNA was mixed with 10 μM primer (oligodT, random hexanucleotides or specific primers), incubated 5 min at 65˚C, and kept on ice for 2 min to allow hybridization. Then, RT reaction Mix (buffer 5X, dNTPs mix 10 mM each one, RNase inhibitor RNaseOUT (40 U/μl) (Invitrogen)) and Reverse Transcriptase were added following manufacturer instructions. After 60 min incubation at 42˚C (M-MuLV) the RT enzyme was heat inactivated at 70˚C for 5 min.</p><p>The real-time PCR reactions were performed using a Strategene Mx3005P QPCR system (Agilent, CA, USA). The reaction mix contained 12.5 μl of Maxima SYBR Green qPCR Master Mix (2&#215;), no ROX (Thermo Scientifics, Massachusetts, USA), 400 nM of each primer, 2 μl of cDNA and nuclease-free water to reach a final volume of 25 μl. The thermal cycling conditions comprised an initial denaturation step of 5 min at 95˚C and 35 - 40 amplification cycles which included denaturation at 95˚C for 30 s and annealing at 54˚C - 70˚C for 60 s (<xref ref-type="table" rid="table1">Table 1</xref>). A melt curve analysis was performed after the last cycle, in order to investigate the specificity of the amplicon and the presence of reaction artefacts such as primer dimer, using a temperature gradient from 60˚C to 100˚C and a ramp speed of 0.5˚C&#183;s<sup>−1</sup> (for 10 s) and continuous fluorescence measurement. Expression levels of the target genes were normalized to the housekeeping gene GAPDH. Gene expression values were then calculated based on the ΔΔCt method using the equation: RQ = 2<sup>−ΔΔCt</sup> [<xref ref-type="bibr" rid="scirp.96517-ref41">41</xref>]. The primer sequences used in PCR reactions and PCR conditions are described in <xref ref-type="table" rid="table1">Table 1</xref>. Each assay was performed in triplicate and repeated three times.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Oligonucleotide primer sequences and PCR programs</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Transcripts</th><th align="center" valign="middle" >Primer Sequences</th><th align="center" valign="middle" >PCR Programs</th><th align="center" valign="middle" >Cycles</th></tr></thead><tr><td align="center" valign="middle" >p53</td><td align="center" valign="middle" >F-5’CGGAGGTCGTGAGACGCTG’3 R-5’CACATGTACTTGTAGTGGATGGTGG’3</td><td align="center" valign="middle" >94˚C-1m/59˚C-1m/72˚C-1m</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >Foxo1</td><td align="center" valign="middle" >F-5’GTGAACACCATGCCTCACAC’3 R-5’CACAGTCCAAGCGCTCAATA’3</td><td align="center" valign="middle" >95˚C-15s/60˚C-1m/72˚C-1m</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >Ins-1</td><td align="center" valign="middle" >F-5’CCTGCTCGTCCTCTGGGAGCCCAAG’3 R-5’CTCCAGTGCCAAGGTCTGAAGATCC’3</td><td align="center" valign="middle" >94˚C-1m/68˚C-1m/72˚C-1m</td><td align="center" valign="middle" >35</td></tr><tr><td align="center" valign="middle" >Ins-2</td><td align="center" valign="middle" >F-5’CCTGCTCATCCTCTGGGAGCCCCGC’3 R-5’CTCCAGTGCCAAGGTCTGAAGGTCA’3</td><td align="center" valign="middle" >94˚C-1m/70˚C-1m/72˚C-1m</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >Sirt-1</td><td align="center" valign="middle" >F-5’AGGGAACCTCTGCCTCATCTAC’3 R-5’GGCATACTCGCCACCTAACCT’3</td><td align="center" valign="middle" >94˚C-1m/60˚C-1m/72˚C-1m</td><td align="center" valign="middle" >35</td></tr><tr><td align="center" valign="middle" >Bcl-2</td><td align="center" valign="middle" >F-5’CAGCTGCACCTGACGCCCTT’3 R-5’CCCAGCCTCCGTTATTCTGGA’3</td><td align="center" valign="middle" >94˚C-1dk/58˚-1dk/72˚C-1dk</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >F-5’GTCGTGGAGTCTACTGGCGTC’3 R-5’GATGACCCTTTTGGCACCACC’3</td><td align="center" valign="middle" >94˚C-1m/54˚C-1m/72˚C-1m</td><td align="center" valign="middle" >35</td></tr></tbody></table></table-wrap><p>p53, Tumor protein 53; Foxo-1, Forkhead box protein O1; Ins-1, Insulin-1; Ins-2, Insulin-2; Sirt-1, Sirtuin-1; Bcl-2, B-cell lymphoma-2; GAPDH, Glucose-6-phosphate dehydrogenase.</p></sec><sec id="s2_8"><title>2.8. Statistical Analysis</title><p>Since normal distribution was not observed Kruskal Wallis test was used followed by the Conover-Iman test. P &lt; 0.05 was considered as statistically significant between the groups. The results were expressed as mean &#177; standard deviation. Data were analyzed with the Statistical Package for the Social Sciences (SPSS) version 20.0 for Windows.</p></sec></sec><sec id="s3"><title>3. Results</title><p>The oxidative stress-related parameters such as NO, TAS, TOS, GSH and OSI are outlined in <xref ref-type="table" rid="table2">Table 2</xref>. Interestingly, resveratrol pretreatment significantly (p &lt; 0.05) increased NO production in RES + B(a)P group compared to B(a)P-treated cells. Resveratrol significantly (p &lt; 0.05) increased the TAS in both RES treated groups. On the other hand, B(a)P (p &lt; 0.05) decreased the TAS level significantly in B(a)P group compared to the CTRL group. These results demonstrated that resveratrol supported the cellular antioxidant defense against B(a)P-induced oxidative events. In OSI levels, there was no significant difference between the RES + B(a)P and B(a)P groups. The GSH levels were significantly (p &lt; 0.05) increased both in the RES group and RES-B(a)P group in comparison with the control and B(a)P group, respectively.</p><p>Resveratrol pretreatment increased insulin production significantly (p &lt; 0.05) in RES and RES + B(a)P groups compared to the CTRL and B(a)P groups, respectively (<xref ref-type="table" rid="table3">Table 3</xref>). Comparison of mRNA expression levels of genes in INS1-E beta cells is presented in <xref ref-type="fig" rid="fig1">Figure 1</xref>. Resveratrol upregulated the FoxO1, a gene related with cell proliferation, by approximately 1.43-fold in RES group in comparison with the control group. The similar upregulation (1.23-fold) of FoxO1 was seen in the B(a)P group too. On the other hand, resveratrol increased the FoxO1 mRNA expression by 1.23-fold in the RES + B(a)P group compared to the B(a)P group (<xref ref-type="fig" rid="fig1">Figure 1</xref>). mRNA expression level of Sirt-1, that has an effective role in the glucose-mediated insulin synthesis, was upregulated by resveratrol in all resveratrol treated groups. This increasing was occurred in the RES + B(a)P group compared to the B(a)P group (<xref ref-type="fig" rid="fig1">Figure 1</xref>). In our study, B(a)P treatment suppressed the mRNA expression of ins-1 gene by 1.70-fold in the B(a)P group compared to the control. The suppression of ins-2 gene expression was 2.17-fold in the same group. These results demonstrate that B(a)P significantly reduces the expression of insulin-encoding genes in this study. On the other hand, resveratrol increased the expression of these two genes in all groups treated with resveratrol (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>The expression of p53 mRNA was 1.40-fold reduced by the B(a)P application in group B(a)P compared to the control grou p. On the other hand, an increase of 1.60-fold was detected in the B(a)P + RES group in comparison with the group which was administrated only with banzo(a)pyrene (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>The antiapoptotic gene BcL-2 was downregulated by 1.15-fold in the B(a)P group in comparison with the control group, while resveratrol increased the expression of this gene by 1.20-fold in B(a)P + RES group comparison with B(a)P group (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Effect of resveratrol on the levels of NO, TAS, TOS, OSI and GSH in cell lysates</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Groups</th><th align="center" valign="middle"  colspan="5"  >Mean (SD)</th></tr></thead><tr><td align="center" valign="middle" >NO (&#181;mol/g prot)</td><td align="center" valign="middle" >TAS (&#181;mol H<sub>2</sub>O<sub>2</sub> Equiv/mg prot)</td><td align="center" valign="middle" >TOS (&#181;mol H<sub>2</sub>O<sub>2</sub> Equiv/mg prot)</td><td align="center" valign="middle" >OSI</td><td align="center" valign="middle" >GSH (&#181;mol/mg prot)</td></tr><tr><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >10.78 (0.53)<sup>a </sup></td><td align="center" valign="middle" >5.48 (0.83)<sup>a </sup></td><td align="center" valign="middle" >1.26 (0.11)<sup>a </sup></td><td align="center" valign="middle" >23.39 (3.27)<sup>a </sup></td><td align="center" valign="middle" >5.80 (0.63)<sup>a </sup></td></tr><tr><td align="center" valign="middle" >RES</td><td align="center" valign="middle" >15.50 (1.20)<sup>bc </sup></td><td align="center" valign="middle" >8.36 (1.09)<sup>b </sup></td><td align="center" valign="middle" >2.85 (0.40)<sup>b </sup></td><td align="center" valign="middle" >34.40 (6.23)<sup>b </sup></td><td align="center" valign="middle" >9.57 (0.99)<sup>b </sup></td></tr><tr><td align="center" valign="middle" >B(a)P</td><td align="center" valign="middle" >12.30 (0.90)<sup>a </sup></td><td align="center" valign="middle" >3.04 (1.35)<sup>a </sup></td><td align="center" valign="middle" >1.09 (0.36)<sup>a </sup></td><td align="center" valign="middle" >13.60 (3.30)<sup>c </sup></td><td align="center" valign="middle" >3.77 (0.28)<sup>c </sup></td></tr><tr><td align="center" valign="middle" >RES + B(a)P</td><td align="center" valign="middle" >17.42 (1.76)<sup>c </sup></td><td align="center" valign="middle" >17.05 (1.53)<sup>c</sup></td><td align="center" valign="middle" >2.88 (0.46)<sup>c</sup></td><td align="center" valign="middle" >16.95 (2.01)<sup>c </sup></td><td align="center" valign="middle" >5.64 (1.50)<sup>a </sup></td></tr></tbody></table></table-wrap><p><sup>a,b,c</sup>: The mean values in a different row are significantly different (p &lt; 0.05). RES: Resveratrol, B(a)P: Benzo(a)pyrene, NO: Nitric oxide, TAS: Total Antioxidant Status, TOS: Total Oxidant Status, OSI: Oxidative Stress Index, GSH: Reduced Glutathione.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Effect of resveratrol on secreted insulin levels</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Groups</th><th align="center" valign="middle" >n</th><th align="center" valign="middle" >Insulin (ng/ml) Mean (SD)</th><th align="center" valign="middle" >P-value <sup>#</sup><sup> </sup></th></tr></thead><tr><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0.49 (0.05)<sup>a </sup></td><td align="center" valign="middle" ><sup> </sup></td></tr><tr><td align="center" valign="middle" >RES</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0.75 (0.09)<sup>bc </sup></td><td align="center" valign="middle" >&lt;0.05<sup> </sup></td></tr><tr><td align="center" valign="middle" >B(a)P</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0.60 (0.01)<sup>b </sup></td><td align="center" valign="middle" >&lt;0.05<sup> </sup></td></tr><tr><td align="center" valign="middle" >RES + B(a)P</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0.99 (0.22)<sup>c </sup></td><td align="center" valign="middle" >&lt;0.05<sup> </sup></td></tr></tbody></table></table-wrap><p><sup>#</sup>Kruskal Wallis test followed by Conover-Iman test; <sup>a,b,c</sup>The mean values in a different row are significantly different (p &lt; 0.05). RES: Resveratrol, B(a)P: Benzo(a)pyrene.</p></sec><sec id="s4"><title>4. Discussion</title><p>Benzo(a)pyrene is known to occur after several combustion reactions [<xref ref-type="bibr" rid="scirp.96517-ref42">42</xref>]. It has been revealed that the air pollution was closely related to diabetes [<xref ref-type="bibr" rid="scirp.96517-ref43">43</xref>].</p><p>The B(a)P metabolism causes overexpression of ROS, which are effective in cancer development, by acting as a second messenger for certain cytokines and growth factors in cells [<xref ref-type="bibr" rid="scirp.96517-ref44">44</xref>]. It was reported that ROS could initiate the peroxidation of lipids [<xref ref-type="bibr" rid="scirp.96517-ref45">45</xref>].</p><p>It is well known that GSH protects the cells against oxidative damage via its thiol groups [<xref ref-type="bibr" rid="scirp.96517-ref46">46</xref>]. It was reported that the B(a)P application significantly reduced the levels of GSH [<xref ref-type="bibr" rid="scirp.96517-ref47">47</xref>]. Similarly, the level of GSH was reduced by B(a)P in our study. This could be explained by the excessive use of GSH in the process of detoxifying of peroxide radicals that were generated by lipid peroxidation. Likewise, this result was supported by the reducing effects of B(a)P on the TAS in beta cells.</p><p>A research study has reported that resveratrol causes an increase in GSH levels in the protective role against oxidative injury [<xref ref-type="bibr" rid="scirp.96517-ref48">48</xref>]. In our study, increase in GSH levels was detected by resveratrol treatment in both RES and B(a)P + RES groups compared to the control and B(a)P groups, respectively. In addition, it has been reported that resveratrol acts as an antioxidant function such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) [<xref ref-type="bibr" rid="scirp.96517-ref49">49</xref>]. This effect of resveratrol is based on its ability to protect the cell membranes against oxidative damage [<xref ref-type="bibr" rid="scirp.96517-ref50">50</xref>]. Resveratrol is known to have potent antioxidant properties and protective capacity against harmful effects induced by lipid peroxidation [<xref ref-type="bibr" rid="scirp.96517-ref51">51</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref52">52</xref>]. Interestingly, there are some studies showing that resveratrol increases iNOS expression and NO production [<xref ref-type="bibr" rid="scirp.96517-ref53">53</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref54">54</xref>]. Consistent with the literature, the level of NO was increased by resveratrol treatments in this study. This effect may be related to the activation of iNOS.</p><p>Resveratrol has been reported to reduce blood sugar and triglyceride levels, and also insulinemia in rats [<xref ref-type="bibr" rid="scirp.96517-ref55">55</xref>]. In consistent with previous studies, RES improved the insulin levels in this study. This effect of RES on insulin secretion could be related to the increased expression of Sirt-1 gene. Kong et al. [<xref ref-type="bibr" rid="scirp.96517-ref56">56</xref>] reported that RES improved glycemic control and insulin levels which was reduced in rats fed with high-fat diets for eight weeks period [<xref ref-type="bibr" rid="scirp.96517-ref56">56</xref>]. From these results, researchers have concluded that RES increased the expression of Sirt-1 gene. The results obtained in our study support the literature data.</p><p>In a study used Zucker diabetic rats, Sirt-1 gene activator improved the homeostasis of glucose and positively affected the sensitivity of insulin in fat, liver and muscle tissues. It was stated in the same study that the activation of Sirt-1 in the treatment of age-related disease and T2DM was a promising new treatment strategy [<xref ref-type="bibr" rid="scirp.96517-ref57">57</xref>].</p><p>It was previously demonstrated that RES increasesd Sirt-1 gene expression in human endothelial cell line EA.HY926 [<xref ref-type="bibr" rid="scirp.96517-ref58">58</xref>]. The same investigators suggested that the anti-inflammatory effect of RES could be achieved with Sirt-1 and AMP-activated kinase (AMPK). In our study, RES increased the mRNA expression level by 1.34-fold in the RES group compared to the control, and by 1.72-fold in the B(a)P + RES group compared to the B(a)P group. In this context, it is suggested that the underlying mechanism in action of RES on GSH regulation due to upregulation of Sirt-1 gene expression as described before. Sirt-1 accelerates the detoxification of ROS by upregulating cellular antioxidant enzymes, including SOD-1, catalase, GPx-1, and thioredoxin-1. GPx-1 regulates cellular oxidant status directly through elimination of hydroperoxides and via oxidation of GSH, the major low-molecular-weight thiol in cells [<xref ref-type="bibr" rid="scirp.96517-ref59">59</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref60">60</xref>]. Thus, our findings suggest that Sirt-1 was upregulated by RES coordinately might increase GSH and GPx necessary for hydrogen peroxide reduction.</p><p>Alternatively, resveratrol may directly increase the level of glutathione with antioxidant effect. Resveratrol has been well known for its possible antioxidant role and protective effects against oxidant damage [<xref ref-type="bibr" rid="scirp.96517-ref61">61</xref>].</p><p>In the present study, we tested the ability of RES to attenuate the B(a)P mediated GSH depletion in INS-1E pancreatic cells. Treatment with RES + B(a)P significantly increased the level of GSH compared with treatment with B(a)P alone. It is possible that RES attenuates B(a)P-mediated depletion of GSH levels by increasing the biosynthesis of GSH and also by scavenging B(a)P-induced ROS. Polyphenolic compounds with hydroxyl groups at 4’ and 5 positions, as seen in resveratrol, have the potential to scavenge free radicals [<xref ref-type="bibr" rid="scirp.96517-ref62">62</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref63">63</xref>]. Our data corroborate previous observations of the ability of RES to scavenge free radicals such as OH and O 2 • − [<xref ref-type="bibr" rid="scirp.96517-ref33">33</xref>] and have been shown to possess the antioxidant property [<xref ref-type="bibr" rid="scirp.96517-ref64">64</xref>].</p><p>The tumor suppressor p53, a transcription factor that is activated by various forms of cellular stress, was one of the earliest detected cancer gene [<xref ref-type="bibr" rid="scirp.96517-ref65">65</xref>]. Sin et al. [<xref ref-type="bibr" rid="scirp.96517-ref65">65</xref>] reported the increased levels of p53 protein in rats treated with the combination of RES, and sirtinol which is a Sirt-1 inhibitor. In this context, the combination consisting of RES and sirtinol can be used for preventing the harmful effects of B(a)P. In our study, although RES was used alone, expression levels of p53 in RES group and B(a)P + RES group were increased by 2.07- and by 1.60-fold compared to the control and B(a)P group, respectively. Therefore, it can be said that apoptosis is stimulated via p53 mediated mechanism reported by Soengas et al. [<xref ref-type="bibr" rid="scirp.96517-ref66">66</xref>], by RES in this study. The role of RES in the induction of apoptosis in various cells is controversial. The agent has been shown to induce apoptosis in cancer cells, such as skin cancer cells [<xref ref-type="bibr" rid="scirp.96517-ref67">67</xref>], and has been shown to play a protective role against apoptosis in human tenocytes [<xref ref-type="bibr" rid="scirp.96517-ref68">68</xref>], endothelial cells [<xref ref-type="bibr" rid="scirp.96517-ref69">69</xref>] and other cell types, particularly under oxidative stress [<xref ref-type="bibr" rid="scirp.96517-ref70">70</xref>]. And in this study, we confirmed the therapeutic role of RES against the reduced-apoptosis in INS-1 pancreatic cells exposure to B(a)P.</p><p>It has been reported that RES has anti-diabetic effects in different in vivo and in vitro studies [<xref ref-type="bibr" rid="scirp.96517-ref71">71</xref>] [<xref ref-type="bibr" rid="scirp.96517-ref72">72</xref>]. Xie et al. [<xref ref-type="bibr" rid="scirp.96517-ref72">72</xref>] showed that RES could induce the expression of several β-cell genes including insulin gene. Animal studies have shown similar beneficial effects of RES by increasing insulin secretion [<xref ref-type="bibr" rid="scirp.96517-ref73">73</xref>] or enhancing sensitivity to insulin in peripheral organs via activation of Sirt-1 [<xref ref-type="bibr" rid="scirp.96517-ref74">74</xref>]. In our study, RES increased the levels of Ins-1 and Ins-2 genes by 2.03- and 1.63-folds respectively, in RES + B(a)P group compared to the B(a)P group. In addition, insulin hormone secretion was significantly increasing in RES + B(a)P group compared with B(a)P group in this study. It has been suggested that these results are consistent with the results of previous studies mentioned above.</p><p>On the other hand, it was shown that RES increased the expression of key β-cell transcription factors such as Foxo1 and Ngn3 [<xref ref-type="bibr" rid="scirp.96517-ref72">72</xref>]. The increased expression of FoxO1 by resveratrol treatment in this study explains and supports the positive effect of RES on insulin levels.</p><p>The expression of the Bcl-2 gene has been reported to be significantly suppressed in the cerebral cortex of rats exposed to B(a)P. This effect of B(a)P was attributed its enhancing effect on apoptosis index [<xref ref-type="bibr" rid="scirp.96517-ref74">74</xref>]. In consistent with the literature, expression of Bcl-2 gene was suppressed by 1.15 fold in the B(a)P group in this study.</p><p>He et al. [<xref ref-type="bibr" rid="scirp.96517-ref75">75</xref>] applied RES as an activator for SIRT1 for preventing the effects of apoptosis induced by H<sub>2</sub>O<sub>2</sub> in mouse osteoblastic cells MC3T3-E1 cell lines. With H<sub>2</sub>O<sub>2</sub> administration, p53, bax and caspase-9 were stimulated while SIRT1 and Bcl-2 were inhibited. It was determined that RES stimulated the activity of both Bcl-2 and SIRT1 genes against this effect of H<sub>2</sub>O<sub>2</sub> [<xref ref-type="bibr" rid="scirp.96517-ref75">75</xref>]. Similarly, RES increased the level of Bcl-2 expression in this study. This increase was also assumed to be effective in removing the reduction in Bcl-2 gene expression caused by B(a)P.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The harmful effects of B(a)P on beta cells of pancreas and therapeutic aspects of RES have been investigated for the first time in this study. For this reason, it is believed that the results obtained here may contribute to the literature. Based on all these results, it can be said that RES may be a very important therapeutic agent in the protection or treatment of adverse effects of carcinogenesis and oxidative changes that may occur due to B(a)P toxication in pancreatic beta cells. The demonstration of these effects of RES reveals how important RES is in preventing the harmful effects of environmental pollutants. The importance of RES-rich foods has been once again revealed by scientific evidence. With further studies, it may be possible to illuminate the cellular or molecular mechanisms underlying these effects of RES.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This study was supported by the Scientific Research Projects Unit of Afyon Kocatepe University (Project No: 10.TIP.18/MSc Thesis in Medical Biochemistry) and NATO-SPS Program (Project No: MYP-G5266). The author wishes to thank Prof. Dr. Suat Erdoğan (Trakya University, Turkey. Ph.D. in Glasgow) for English revision of the text.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>&#199;elik, S., Baysal, B. and Şen, S. (2019) Resveratrol Attenuates Benzo(a)pyrene-Induced Dysfunctions, Oxidative Stress and Apoptosis in Pancreatic Beta-Cells. Advances in Bioscience and Biotechnology, 10, 389-404. https://doi.org/10.4236/abb.2019.1011029</p></sec></body><back><ref-list><title>References</title><ref id="scirp.96517-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Dodds, S. (2017) The How-To for Type 2: An Overview of Diagnosis and Management of Type 2 Diabetes Mellitus. Nursing Clinics of North America, 52, 513-522.  
https://doi.org/10.1016/j.cnur.2017.07.002</mixed-citation></ref><ref id="scirp.96517-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Felton, A.M., LaSalle, J. and McGill, M. (2016) Global Partnership for Effective Diabetes Management. Treatment Urgency: The Importance of Getting People with Type 2 Diabetes to Target Promptly. Diabetes Research and Clinical Practice, 117, 100-103. https://doi.org/10.1016/j.diabres.2016.04.026</mixed-citation></ref><ref id="scirp.96517-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Sazlina, S.G., Mastura, I., Ahmad, Z., Cheong, A.T., Adam, B.M., Jamaiyah, H., Lee, P.Y., Syed-Alwi, S.A., Chew, B.H. and Sriwahyu, T. (2014) Control of Glycemia and Other Cardiovascular Disease Risk Factors in Older Adults with Type 2 Diabetes Mellitus: Data from the Adult Diabetes Control and Management. Geriatrics &amp; Gerontology International, 14, 130-137. https://doi.org/10.1111/ggi.12070</mixed-citation></ref><ref id="scirp.96517-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Lee, E., Ryu, G.R., Ko, S.H., Ahn, Y.B. and Song, K.H. (2017) A Role of Pancreatic Stellate Cells in Islet Fibrosis and β-Cell Dysfunction in Type 2 Diabetes Mellitus. Biochemical and Biophysical Research Communications, 485, 328-334.  
https://doi.org/10.1016/j.bbrc.2017.02.082</mixed-citation></ref><ref id="scirp.96517-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Butler, A.E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R.A. and Butler, P.C. (2003) Beta-Cell Deficit and Increased Beta-Cell Apoptosis in Humans with T2DM. Diabetes, 52, 102-110. https://doi.org/10.2337/diabetes.52.1.102</mixed-citation></ref><ref id="scirp.96517-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kesavulu, M.M., Rao, B.K., Giri, R., Vijaya, J., Subramanyam, G. and Apparao, C. (2001) Lipid Peroxidation and Antioxidant Enzyme Status in Type 2 Diabetics with Coronary Heart Disease. Diabetes Research and Clinical Practice, 53, 33-39.  
https://doi.org/10.1016/S0168-8227(01)00238-8</mixed-citation></ref><ref id="scirp.96517-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Bhor, V.M., Raghuram, N. and Sivakami, S. (2004) Oxidative Damage and Altered Antioxidant Enzyme Activities in the Small Intestine of Streptozotocin-Induced Diabetic Rats. The International Journal of Biochemistry &amp; Cell Biology, 36, 89-97.  
https://doi.org/10.1016/S1357-2725(03)00142-0</mixed-citation></ref><ref id="scirp.96517-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Ozsoy-Sacan, O., Karabulut-Bulan, O., Bolkent, S., Yanardag, R. and Ozgey, Y. (2004) Effects of Chard (Beta vulgaris L. var cicla) on the Liver of the Diabetic Rats: A Morphological and Biochemical Study. Bioscience, Biotechnology, and Biochemistry, 68, 1640-1648. https://doi.org/10.1271/bbb.68.1640</mixed-citation></ref><ref id="scirp.96517-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Venkateswaran, S. and Pari, L. (2003) Effect of Coccinia indica Leaf Extract on Plasma Antioxidants in Streptozotocin-Induced Experimental Diabetes in Rats. Phytotherapy Research, 17, 605-608. https://doi.org/10.1002/ptr.1195</mixed-citation></ref><ref id="scirp.96517-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Eizirik, D.L. and Poulsen, T.M. (2001) A Choice of Death—The Signal-Transduction of Immune-Mediated Beta Cell Apoptosis. Diabetologia, 44, 2115-2133.  
https://doi.org/10.1007/s001250100021</mixed-citation></ref><ref id="scirp.96517-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Mathis, D., Vence, L. and Benoist, C. (2001) Beta-Cell Death during Progression to Diabetes. Nature, 414, 792-798. https://doi.org/10.1038/414792a</mixed-citation></ref><ref id="scirp.96517-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Kaneto, H., Kajimoto, Y., Miyagawa, J., Matsuoka, T., Fujitani, Y., Umayahara, Y., Hanafusa, T., Matsuzawa, Y., Yamasaki, Y. and Hori, M. (1999) Beneficial Effects of Antioxidants in Diabetes: Possible Protection of Pancreatic Beta-Cells against Glucose Toxicity. Diabetes, 48, 2398-2406. https://doi.org/10.2337/diabetes.48.12.2398</mixed-citation></ref><ref id="scirp.96517-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I., Akira, S., Araki, E. and Mori, M. (2001) Nitric Oxide-Induced Apoptosis in Pancreatic Beta Cells Is Mediated by the Endoplasmic Reticulum Stress Pathway. Proceedings of the National Academy of Sciences of the United States of America, 98, 10845-10850. https://doi.org/10.1073/pnas.191207498</mixed-citation></ref><ref id="scirp.96517-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Saini, K.S., Thompson, C., Winterford, C.M., Walker, N.I. and Cameron, D.P. (1996) Streptozotocin at Low Doses Induces Apoptosis and at High Doses Causes Necrosis in a Murine Pancreatic Beta Cell Line, INS-1. Biochemistry and Molecular Biology International, 39, 1229-1236. https://doi.org/10.1080/15216549600201422</mixed-citation></ref><ref id="scirp.96517-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Unger, R.H. (2002) Lipotoxic Diseases. Annual Review of Medicine, 53, 319-336.  
https://doi.org/10.1146/annurev.med.53.082901.104057</mixed-citation></ref><ref id="scirp.96517-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Withers, D.J., Burks, D.J., Towery, H.H., Altamuro, S.L., Flint, C.L. and White, M.F. (1999) Irs-2 Coordinates Igf-1 Receptor-Mediated Beta-Cell Development and Peripheral Insulin Signalling. Nature Genetics, 23, 32-40.  
https://doi.org/10.1038/12631</mixed-citation></ref><ref id="scirp.96517-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Longnecker, M.P. and Daniels, J.L. (2001) Environmental Contaminants as Etiologic Factors for Diabetes. Environmental Health Perspectives, 109, 871-876.  
https://doi.org/10.1289/ehp.01109s6871</mixed-citation></ref><ref id="scirp.96517-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Henriksen, G.L., Ketchum, N.S., Michalek, J.E. and Swaby, J.A. (1997) Serum Dioxin and Diabetes Mellitus in Veterans of Operation Ranch Hand. Epidemiology, 8, 252-825. https://doi.org/10.1097/00001648-199705000-00005</mixed-citation></ref><ref id="scirp.96517-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Bertazzi, P.A., Consonni, D., Bachetti, S., Rubagotti, M., Baccerelli, A., Zocchetti, C. and Pesatori, A.C. (2001) Health Effects of Dioxin Exposure: A 20-Year Mortality Study. American Journal of Epidemiology, 153, 1031-1044.  
https://doi.org/10.1093/aje/153.11.1031</mixed-citation></ref><ref id="scirp.96517-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Steenland, K., Calvert, G., Ketchum, N. and Michalek, J. (2001) Dioxin and Diabetes Mellitus: An Analysis of the Combined NIOSH and Ranch Hand Data. Occupational and Environmental Medicine, 58, 641-648. https://doi.org/10.1136/oem.58.10.641</mixed-citation></ref><ref id="scirp.96517-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Vasiliu, O., Cameron, L., Gardiner, J., Deguire, P. and Karmaus, W. (2006) Polybrominated Biphenyls, Polychlorinated Biphenyls, Body Weight, and Incidence of Adult Onset Diabetes Mellitus. Epidemiology, 17, 352-359.  
https://doi.org/10.1097/01.ede.0000220553.84350.c5</mixed-citation></ref><ref id="scirp.96517-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Aygün, S.F. and Kabadayi, F. (2005) Determination of Benzo[a]pyrene in Charcoal Grilled Meat Samples by HPLC with Fluorescence Detection. International Journal of Food Sciences and Nutrition, 56, 581-585.  
https://doi.org/10.1080/09637480500465436</mixed-citation></ref><ref id="scirp.96517-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Gelboin, H.V. (1980) Benzo[alpha]pyrene Metabolism, Activation and Carcinogenesis: Role and Regulation of Mixed-Function Oxidases and Related Enzymes. Physiological Reviews, 60, 1107-1166. https://doi.org/10.1152/physrev.1980.60.4.1107</mixed-citation></ref><ref id="scirp.96517-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, S., Antony, M. and Mehrotra, N.K. (1982) Induction of Benzo[a]pyrene Hydroxylase in Skin and Liver by Cutaneous Application of Jute Batching Oil. Toxicology, 23, 347-352. https://doi.org/10.1016/0300-483X(82)90072-5</mixed-citation></ref><ref id="scirp.96517-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Chen, Z., Jin, K., Gao, L., Lou, G., Jin, Y., Yu, Y. and Lou, Y. (2010) Anti-Tumor Effects of Bakuchiol, an Analogue of Resveratrol, on Human Lung Adenocarcinoma A549 Cell Line. European Journal of Pharmacology, 25, 170-179.  
https://doi.org/10.1016/j.ejphar.2010.06.025</mixed-citation></ref><ref id="scirp.96517-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Bae, S., Lee, E.M., Cha, H.J., Kim, K., Yoon, Y., Lee, H., et al. (2011) Resveratrol Alters microRNA Expression Profiles in A549 Human Non-Small Cell Lung Cancer Cells. Molecules and Cells, 32, 243-249. https://doi.org/10.1007/s10059-011-1037-z</mixed-citation></ref><ref id="scirp.96517-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, W., Wang, X. and Chen, T. (2011) Resveratrol Induces Mitochondria-Mediated AIF and to a Lesser Extent Caspase-9-Dependent Apoptosis in Human Lung Adenocarcinoma ASTC-a-1 Cells. Molecular and Cellular Biochemistry, 354, 29-37. https://doi.org/10.1007/s11010-011-0802-9</mixed-citation></ref><ref id="scirp.96517-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Vetterli, L., Brun, T., Giovannoni, L., Bosco, D. and Maechler, P. (2011) Resveratrol Potentiates Glucose-Stimulated Insulin Secretion in INS-1E Beta-Cells and Human Islets through a SIRT1-Dependent Mechanism. The Journal of Biological Chemistry, 286, 6049-6060. https://doi.org/10.1074/jbc.M110.176842</mixed-citation></ref><ref id="scirp.96517-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., Machado, D.E., et al. (2004) Sirt1 Promotes Fat Mobilization in White Adipocytes by Repressing PPAR-Gamma. Nature, 429, 771-776. https://doi.org/10.1038/nature02583</mixed-citation></ref><ref id="scirp.96517-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Bordone, L., Motta, M.C., Picard, F., Robinson, A., Jhala, U.S., Apfeld, J., et al. (2006) Sirt1 Regulates Insulin Secretion by Repressing UCP2 in Pancreatic Beta Cells. PLOS Biology, 4, e31. https://doi.org/10.1371/journal.pbio.0040031</mixed-citation></ref><ref id="scirp.96517-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Ramsey, K.M., Mills, K.F., Satoh, A. and Imai, S. (2008) Age-Associated Loss of Sirt1 Mediated Enhancement of Glucose-Stimulated Insulin Secretion in Beta Cell-Specific Sirt1-Overexpressing (BESTO) Mice. Aging Cell, 7, 78-88.  
https://doi.org/10.1111/j.1474-9726.2007.00355.x</mixed-citation></ref><ref id="scirp.96517-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Wu, L., Zhou, L., Lu, Y., Zhang, J., Jian, F., Liu, Y., et al. (2012) Activation of SIRT1 Protects Pancreatic β-Cells against Palmitate-Induced Dysfunction. Biochimica et Biophysica Acta, 1822, 1815-1825. https://doi.org/10.1016/j.bbadis.2012.08.009</mixed-citation></ref><ref id="scirp.96517-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Kode, A., Rajendrasozhan, S., Caito, S., Yang, S.R., Megson, I.L. and Rahman, I. (2008) Resveratrol Induces Glutathione Synthesis by Activation of Nrf2 and Protects against Cigarette Smoke-Mediated Oxidative Stress in Human Lung Epithelial Cells. The American Journal of Physiology—Lung Cellular and Molecular Physiology, 294, 478-488. https://doi.org/10.1152/ajplung.00361.2007</mixed-citation></ref><ref id="scirp.96517-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Tampioa, M., Loikkanena, J., Myllynenb, P., Mertanena, A. and Vahakangasa, K.H. (2008) Benzo(a)pyrene Increases Phosphorylation of p53 at Serine 392 in Relation to p53 Induction and Cell Death in MCF-7 Cells. Toxicology Letters, 178, 152-159.  
https://doi.org/10.1016/j.toxlet.2008.03.006</mixed-citation></ref><ref id="scirp.96517-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Bradford, M.M. (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Analytical Biochemistry, 72, 248-254. https://doi.org/10.1016/0003-2697(76)90527-3</mixed-citation></ref><ref id="scirp.96517-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Erel, O. (2004) A Novel Automated Method to Measure Total Antioxidant Response against Potent Free Radical Reactions. Clinical Biochemistry, 37, 112-119.  
https://doi.org/10.12691/jfnr-2-8-1</mixed-citation></ref><ref id="scirp.96517-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Erel, O. (2005) A New Automated Colorimetric Method for Measuring Total Oxidant Status. Clinical Biochemistry, 38, 1103-1111.  
https://doi.org/10.1016/j.clinbiochem.2005.08.008</mixed-citation></ref><ref id="scirp.96517-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Esen, C., Alkan, B.A., Kirnap, M., Akgül, O., Isikoglu, S. and Erel, O. (2012) The Effects of Chronic Periodontitis and Rheumatoid Arthritis on Serum and Gingival Crevicular Fluid Total Antioxidant/Oxidant Status and Oxidative Stress Index. Journal of Periodontology, 83, 773-779. https://doi.org/10.1902/jop.2011.110420</mixed-citation></ref><ref id="scirp.96517-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S. and Tannenbaum, S.R. (1982) Analysis of Nitrate, Nitrite, and [15N]nitrate in Biological Fluids. Analytical Biochemistry, 126, 131-138.  
https://doi.org/10.1016/0003-2697(82)90118-X</mixed-citation></ref><ref id="scirp.96517-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Buetler, E., Dubon, O. and Kelly, B.M. (1963) Improved Method for the Determination of Blood Glutathione. Journal of Laboratory and Clinical Medicine, 61, 882-888.</mixed-citation></ref><ref id="scirp.96517-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Pfaffl, M.W. (2001) A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Research, 29, e45.  
https://doi.org/10.1093/nar/29.9.e45</mixed-citation></ref><ref id="scirp.96517-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Tafeeva, E.A., Ivanov, A.V., Titova, A.A. and Akhmetzianova, I.F. (2015) Air Pollutions as a Risk Factor for the Population Health in Kazan City. Gigiena i Sanitariia, 94, 37-40.</mixed-citation></ref><ref id="scirp.96517-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Esposito, K., Petrizzo, M., Maiorino, M.I., Bellastella, G. and Giugliano, D. (2016) Particulate Matter Pollutants and Risk of T2DM: A Time for Concern? Endocrine, 51, 32-37. https://doi.org/10.1007/s12020-015-0638-2</mixed-citation></ref><ref id="scirp.96517-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Sundaresan, M., Yu, Z.X., Ferrans, V.J., Irani, K. and Finkel, T. (1995) Requirement for Generation of H2O2 for Platelet-Derived Growth Factor Signal Transduction. Science, 270, 296-299. https://doi.org/10.1126/science.270.5234.296</mixed-citation></ref><ref id="scirp.96517-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Rajendran, P., Venogopal, R., Ekambaram, G., Aadithya, A. and Sakthisekaran, D. (2008) Rehabilitating Activity of Mangiferin in Benzo(a)pyrene Induced Lung Carcinogenesis. Asian Journal of Biochemistry, 3, 118-125.  
https://doi.org/10.3923/ajb.2008.118.125</mixed-citation></ref><ref id="scirp.96517-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Aksoy, Y. (2002) The Role of Glutathione in Antioxidant Mechanism. Turkiye Klinikleri Journal of Medical Sciences, 22, 442-448.  
https://doi.org/10.1016/S0737-0806(02)70162-7</mixed-citation></ref><ref id="scirp.96517-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Wu, Y.M. and Zhang, P.Y. (2015) Protective Effects of Curcumin and Quercetin during Benzo(a)pyrene Induced Lung Carcinogenesis in Mice. European Review for Medical and Pharmacological Sciences, 19, 1736-1743.</mixed-citation></ref><ref id="scirp.96517-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Sakr, H.F., Abbas, A.M., Elsamanoudy, A.Z. and Ghoneim, F.M. (2015) Effect of Fluoxetine and Resveratrol on Testicular Functions and Oxidative Stress in a Rat Model of Chronic Mild Stress-Induced Depression. Journal of Physiology and Pharmacology, 66, 515-527.</mixed-citation></ref><ref id="scirp.96517-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Spanier, G., Xu, H., Xia, N., Tobias, S., Deng, S., Wojnowski, L., et al. (2009) Resveratrol Reduces Endothelial Oxidative Stress by Modulating the Gene Expression of Superoxide Dismutase 1 (SOD1), Glutathione Peroxidase 1 (GPx1) and NADPH Oxidase Subunit (Nox4). Journal of Physiology and Pharmacology, 60, 111-116.</mixed-citation></ref><ref id="scirp.96517-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Vardi, N., Parlakpinar, H., Ates, B., Cetin, A. and Otlu, A. (2009) Antiapoptotic and Antioxidant Effects of β-Carotene against Methotrexate-Induced Testicular Injury. Fertility and Sterility, 92, 2028-2033. https://doi.org/10.1016/j.fertnstert.2008.09.015</mixed-citation></ref><ref id="scirp.96517-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Frankel, E.N., Waterhouse, A.L. and Kinsella, J.E. (1993) Inhibition of Human LDL Oxidation by Resveratrol. The Lancet, 341, 1103-1104.  
https://doi.org/10.1016/0140-6736(93)92472-6</mixed-citation></ref><ref id="scirp.96517-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Q., Xu, J., Rottinghaus, G.E., Simonyi, A., Lubahn, D., Sun, G.Y. and Sun, A.Y. (2002) Resveratrol Protects against Global Cerebral Ischemic Injury in Gerbils. Brain Research, 958, 439-947. https://doi.org/10.1016/S0006-8993(02)03543-6</mixed-citation></ref><ref id="scirp.96517-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Giovannini, L., Migliori, M., Longoni, B.M., Das, D.K., Bertelli, A.A., Panichi, V., et al. (2001) Resveratrol, a Polyphenol Found in Wine, Reduces Ischemia Reperfusion Injury in Rat Kidneys. Journal of Cardiovascular Pharmacology, 37, 262-270.  
https://doi.org/10.1097/00005344-200103000-00004</mixed-citation></ref><ref id="scirp.96517-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Kim, J.K., Fillmore, J.J., Sunshine, M.J., Albrecht, B., Higashimori, T., Kim, D.W., et al. (2004) PKCtheta Knockout Mice Are Protected from Fat-Induced Insulin Resistance. Journal of Clinical Investigation, 114, 823-827.  
https://doi.org/10.1172/JCI200422230</mixed-citation></ref><ref id="scirp.96517-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Cai, D., Yuan, M., Frantz, D.F., Melendez, P.A., Hansen, L., Lee, J., et al. (2005) Local and Systemic Insulin Resistance Resulting from Hepatic Activation of IKK-Beta and NF-kappaB. Nature Medicine, 11, 183-190. https://doi.org/10.1038/nm1166</mixed-citation></ref><ref id="scirp.96517-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Kong, W., Chen, L.L., Zheng, J., Zhang, H.H., Hu, X., Zeng, T.S., et al. (2015) Resveratrol Supplementation Restores High-Fat Diet-Induced Insulin Secretion Dysfunction by Increasing Mitochondrial Function in Islet. Experimental Biology and Medicine (Maywood), 240, 220-229. https://doi.org/10.1177/1535370214548998</mixed-citation></ref><ref id="scirp.96517-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">Moynihan, K.A., Plueger, M.M., Bernal-Mizrachi, E., Ford, E., Cras-Meneur, C., Permutt, M.A., et al. (2005) Increased Dosage of Mammalian Sir2 in Pancreatic Beta Cells Enhances Glucose-Stimulated Insulin Secretion in Mice. Cell Metabolism, 2, 105-117. https://doi.org/10.1016/j.cmet.2005.07.001</mixed-citation></ref><ref id="scirp.96517-ref58"><label>58</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Z., Jiang, C., Zhang, J., Liu, B. and Du, Q. (2016) Resveratrol Inhibits Inflammation and Ameliorates Insulin Resistant Endothelial Dysfunction via Regulation of AMP-Activated Protein Kinase and Sirtuin 1 Activities. Journal of Diabetes, 8, 324-335. https://doi.org/10.1111/1753-0407.12296</mixed-citation></ref><ref id="scirp.96517-ref59"><label>59</label><mixed-citation publication-type="other" xlink:type="simple">Rotruck, J.T., Pope, A.L., Ganther, H.E. and Hoekstra, W.G. (1972) Prevention of Oxidative Damage to Rat Erythrocytes by Dietary Selenium. The Journal of Nutrition, 102, 689-696. https://doi.org/10.1093/jn/102.5.689</mixed-citation></ref><ref id="scirp.96517-ref60"><label>60</label><mixed-citation publication-type="other" xlink:type="simple">Rotruck, J.T., Pope, A.L., Ganther, H.E., Swanson, A.B., Hafeman, D.G. and Hoekstra, W.G. (1973) Selenium: Biochemical Role as a Component of Glutathione Peroxidase. Science, 179, 588-590. https://doi.org/10.1126/science.179.4073.588</mixed-citation></ref><ref id="scirp.96517-ref61"><label>61</label><mixed-citation publication-type="other" xlink:type="simple">Kawada, N., Seki, S., Inoue, M. and Kuroki, T. (1998) Effect of Antioxidants, Resveratrol, Quercetin, and N-Acetylcysteine, on the Functions of Cultured Rat Hepatic Stellate Cells and Kupffer Cells. Hepatology, 27, 1265-1274.  
https://doi.org/10.1002/hep.510270512</mixed-citation></ref><ref id="scirp.96517-ref62"><label>62</label><mixed-citation publication-type="other" xlink:type="simple">Fauconneau, B., Waffo-Teguo, P., Huguet, F., Barrier, L., Decendit, A. and Merillon, J.M. (1997) Comparative Study of Radical Scavenger and Antioxidant Properties of Phenolic Compounds from Vitis vinifera Cell Cultures Using in Vitro Tests. Life Sciences, 61, 2103-2110. https://doi.org/10.1016/S0024-3205(97)00883-7</mixed-citation></ref><ref id="scirp.96517-ref63"><label>63</label><mixed-citation publication-type="other" xlink:type="simple">Teissedre, P.L., Frankel, E.N., Waterhouse, A.L., Peleg, H. and German, J.B. (1996) Inhibition of in Vitro Human LDL Oxidation by Phenolic Antioxidants from Grapes and Wines. Journal of the Science of Food and Agriculture, 70, 55-61.  
https://doi.org/10.1002/(SICI)1097-0010(199601)70:1&lt;55::AID-JSFA471&gt;3.3.CO;2-O</mixed-citation></ref><ref id="scirp.96517-ref64"><label>64</label><mixed-citation publication-type="other" xlink:type="simple">Brito, P.M., Mariano, A., Almeida, L.M. and Dinis, T.C. (2006) Resveratrol Affords Protection against Peroxynitrite-Mediated Endothelial Cell Death: A Role for Intracellular Glutathione. Chemico-Biological Interactions, 164, 157-166.  
https://doi.org/10.1016/j.cbi.2006.09.007</mixed-citation></ref><ref id="scirp.96517-ref65"><label>65</label><mixed-citation publication-type="other" xlink:type="simple">Sin, T.K., Yung, B.Y., Yip, S.P., Chan, L.W., Wong, C.S., Tam, E.W., et al. (2015) SIRT1-Dependent Myoprotective Effects of Resveratrol on Muscle Injury Induced by Compression. Frontiers in Physiology, 6, 293.  
https://doi.org/10.3389/fphys.2015.00293</mixed-citation></ref><ref id="scirp.96517-ref66"><label>66</label><mixed-citation publication-type="other" xlink:type="simple">Soengas, M.S., Alarcón, R.M., Yoshida, H., Giaccia, A.J., Hakem, R., Mak, T.W. and Lowe, S.W. (1999) Apaf-1 and Caspase-9 in p53-Dependent Apoptosis and Tumor Inhibition. Science, 284, 156-159. https://doi.org/10.1126/science.284.5411.156</mixed-citation></ref><ref id="scirp.96517-ref67"><label>67</label><mixed-citation publication-type="other" xlink:type="simple">Dun, J., Chen, X., Gao, H., Zhang, Y., Zhang, H. and Zhang, Y. (2015) Resveratrol Synergistically Augments Anti-Tumor Effect of 5-FU in Vitro and in Vivo by Increasing S-Phase Arrest and Tumor Apoptosis. Experimental Biology and Medicine (Maywood), 240, 1672-1681. https://doi.org/10.1177/1535370215573396</mixed-citation></ref><ref id="scirp.96517-ref68"><label>68</label><mixed-citation publication-type="other" xlink:type="simple">Busch, F., Mobasheri, A., Shayan, P., Stahlmann, R. and Shakibaei, M. (2012) Sirt-1 Is Required for the Inhibition of Apoptosis and Inflammatory Responses in Human Tenocytes. The Journal of Biological Chemistry, 287, 25770-25781.  
https://doi.org/10.1074/jbc.M112.355420</mixed-citation></ref><ref id="scirp.96517-ref69"><label>69</label><mixed-citation publication-type="other" xlink:type="simple">Csiszár, A., Csiszar, A., Pinto, J.T., Gautam, T., Kleusch, C., Hoffmann, B. and Tucsek, Z. (2015) Resveratrol Encapsulated in Novel Fusogenic Liposomes Activates Nrf2 and Attenuates Oxidative Stress in Cerebromicrovascular Endothelial Cells from Aged Rats. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 70, 303-313. https://doi.org/10.1093/gerona/glu029</mixed-citation></ref><ref id="scirp.96517-ref70"><label>70</label><mixed-citation publication-type="other" xlink:type="simple">Chan, C.M., Huang, C.H., Li, H.J., Hsiao, C.Y., Su, C.C., Lee, P.L. and Hung, C.F. (2015) Protective Effects of Resveratrol against UVA-Induced Damage in ARPE19 Cells. International Journal of Molecular Sciences, 16, 5789-5802.  
https://doi.org/10.3390/ijms16035789</mixed-citation></ref><ref id="scirp.96517-ref71"><label>71</label><mixed-citation publication-type="other" xlink:type="simple">Timmers, S., Hesselink, M.K. and Schrauwen, P. (2013) Therapeutic Potential of Resveratrol in Obesity and T2DM: New Avenues for Health Benefits? Annals of the New York Academy of Sciences, 3, 83-89. https://doi.org/10.1111/nyas.12185</mixed-citation></ref><ref id="scirp.96517-ref72"><label>72</label><mixed-citation publication-type="other" xlink:type="simple">Xie, S., Sinha, R.A., Singh, B.K., Li, G.D., Han, W. and Yen, P.M. (2013) Resveratrol Induces Insulin Gene Expression in Mouse Pancreatic α-Cells. Cell &amp; Bioscience, 13, 47. https://doi.org/10.1186/2045-3701-3-47</mixed-citation></ref><ref id="scirp.96517-ref73"><label>73</label><mixed-citation publication-type="other" xlink:type="simple">Szkudelski, T. and Szkudelska, K. (2011) Anti-Diabetic Effects of Resveratrol. Annals of the New York Academy of Sciences, 3, 34-39.  
https://doi.org/10.1111/j.1749-6632.2010.05844.x</mixed-citation></ref><ref id="scirp.96517-ref74"><label>74</label><mixed-citation publication-type="other" xlink:type="simple">Gertz, M., Nguyen, G.T., Fischer, F., Suenkel, B., Schlicker, C., Franzel, B., et al. (2012) A Molecular Mechanism for Direct Sirtuin Activation by Resveratrol. PLoS ONE, 3, e49761. https://doi.org/10.1371/journal.pone.0049761</mixed-citation></ref><ref id="scirp.96517-ref75"><label>75</label><mixed-citation publication-type="other" xlink:type="simple">He, N., Zhu, X., He, W., Zhao, S., Zhao, W. and Zhu, C. (2015) Resveratrol Inhibits the Hydrogen Dioxide-Induced Apoptosis via Sirt 1 Activation in Osteoblast Cells. Bioscience, Biotechnology, and Biochemistry, 79, 1779-1186.  
https://doi.org/10.1080/09168451.2015.1062712</mixed-citation></ref></ref-list></back></article>