<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2018.911162</article-id><article-id pub-id-type="publisher-id">AJPS-88001</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Cloning and Expression Analysis of RrG-Beta1 Gene Related to Anthocyanin Biosynthesis in &lt;i&gt;Rosa rugose&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yenan</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mingyuan</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xu</surname><given-names>Han</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lanyong</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zongda</surname><given-names>Xu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Forestry, Shandong Agricultural University, Taian, China</addr-line></aff><pub-date pub-type="epub"><day>11</day><month>10</month><year>2018</year></pub-date><volume>09</volume><issue>11</issue><fpage>2244</fpage><lpage>2255</lpage><history><date date-type="received"><day>20,</day>	<month>September</month>	<year>2018</year></date><date date-type="rev-recd"><day>22,</day>	<month>October</month>	<year>2018</year>	</date><date date-type="accepted"><day>25,</day>	<month>October</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  As an important signal transduction protein, G protein beta subunit gene encoded by oligonucleotides plays an important role in many physiological, biochemical and environmental stresses in plants. In order to understand the action mode of G protein beta subunit gene, this paper cloned a 
  Wd40 gene related to G protein beta subunit gene, named RrG-beta1, based on the 
  R. rugose—transcriptome data, using 
  Rosa rugose “Zi zhi” as experimental materials. The full length of cDNA of the gene was obtained by RT-PCR and RACE methods. The total length of this gene is 981 bp, and it encodes 326 amino acids. After bioinformatics analysis, the molecular formula C
  <sub>1601</sub>H
  <sub>2520</sub>N
  <sub>450</sub>O
  <sub>486</sub>S
  <sub>11</sub> was predicted; the relative molecular weight was 36,201.00 Da; the theoretical isoelectric point PI value was 6.71; and its instability index was 30.44. The total average hydrophobic index was -0.847. In the secondary structure of RrG-beta1 protein, there are 17 
  α-helix, 131 Random coil, and 141 extended peptide chain. Gene Bank Blast results showed that the amino acid sequence encoded by RrG-beta1 was more than 90% homologous with the beta-like protein of 
  Rosa chinensis, 
  Fragaria, 
  Malus, 
  Pyrus, 
  Prunus, 
  Arabidopsis and 
  tobacco, so it can be inferred that the RrG-beta1 Gene is guanine nucleotide-binding protein subunit beta-like protein. Fluorescence quantitative expression analysis of RrG-beta1 protein decreased with the development of flower color, and it was speculated that it could exert negative regulation effect on flower color. The leaf expression was highest in the tissue part, so it was inferred that the signal was transmitted through the stoma on the leaf.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Rosa rugose&lt;/i&gt;</kwd><kwd> &lt;i&gt;Gβ&lt;/i&gt;</kwd><kwd> Signal Transduction</kwd><kwd> Drought Stress</kwd><kwd> Gene Expression</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Rosa rugosa is an ornamental shrub of the Rosaceae family，it has long history of cultivation, so people call it “flower queen” [<xref ref-type="bibr" rid="scirp.88001-ref1">1</xref>] . The roses were gorgeous and fragrant. Because of its easy cultivation and management, rose has an important role in landscaping and greening [<xref ref-type="bibr" rid="scirp.88001-ref2">2</xref>] . As a functional protein of a stable complex, Wd40 has a variety of biochemical and cellular biological functions, mainly including signal transduction, RNA processing vesicle transport, cytoskeleton assembly and a variety of biological processes [<xref ref-type="bibr" rid="scirp.88001-ref3">3</xref>] . For example, it can form MBW complex with MYB and BHLH to regulate anthocyanin biosynthesis [<xref ref-type="bibr" rid="scirp.88001-ref4">4</xref>] and can interact with Rack1 to regulate plant physiology, biochemistry and response to environmental stress [<xref ref-type="bibr" rid="scirp.88001-ref5">5</xref>] . Beta subunit gene refers to a protein that can bind to guanine nucleotides. It is the earliest discovered Wd40 protein, which is composed of trimer protein and “small Gi” protein [<xref ref-type="bibr" rid="scirp.88001-ref6">6</xref>] . Among them, heterologous trimer G protein is composed of three subunits α, β, γ; the receptor is activated after binding with the signaling molecule [<xref ref-type="bibr" rid="scirp.88001-ref7">7</xref>] . The activated receptor further activates the corresponding G protein, and then delivers to the corresponding effectors at the first level to regulate the physiological functions of plants [<xref ref-type="bibr" rid="scirp.88001-ref8">8</xref>] . Gβ is a typical Wd40 repeat protein with only known spatial structure [<xref ref-type="bibr" rid="scirp.88001-ref9">9</xref>] . This gene has been cloned from most mammals, but little research has been done in higher plants [<xref ref-type="bibr" rid="scirp.88001-ref10">10</xref>] . At present, only Zea mays [<xref ref-type="bibr" rid="scirp.88001-ref11">11</xref>] , Arabidopsis [<xref ref-type="bibr" rid="scirp.88001-ref12">12</xref>] , Tobacco [<xref ref-type="bibr" rid="scirp.88001-ref13">13</xref>] and Oryza sativa [<xref ref-type="bibr" rid="scirp.88001-ref14">14</xref>] were cloned and analyzed. At present, there are systematic studies on the functions of Gβ protein in mammals and simple eukaryotic cells [<xref ref-type="bibr" rid="scirp.88001-ref15">15</xref>] . However, there are few studies on higher plants. It is not clear whether the signal pathway of Gβ protein in plants is consistent with that in animals and whether there is a protein that plays a role together with Gβ protein.</p></sec><sec id="s2"><title>2. Material and Methods</title><p>The experiment was conducted from April 2017 to January 2018 in the flower germplasm resources nursery of Shandong agricultural university and the flower research institute of forestry university.</p><sec id="s2_1"><title>2.1. Plant Material</title><p>The plant materials, Chinese representative Rosa rugosa “Zi zhi”, Rosa rugosa “Bai zi zhi” Plants were selected from April to May 2017 with robust, stable and pure designs, and the half-open petals of the above three varieties were collected as the experimental materials for gene cloning. The flower petals of the above three varieties were collected in the bud stage, the initial stage, the half stage, the blooming stage and the end of the blooming period as the differential expression test among the varieties; Five flowering stages and root, stem, leaf, pistil, stamen, sepals were collected for tissue differential expression test. All samples were collected directly frozen with liquid nitrogen, and finally stored at −80˚C until used.</p></sec><sec id="s2_2"><title>2.2. Methods</title><sec id="s2_2_1"><title>2.2.1. Total RNA Extraction and cDNA Synthesis</title><p>According to the instructions of EASY spin plant RNA rapid extraction kit (Aidlab Biotech, Beijing, China), RNA of all tissue parts and total RNA of Rosa rugosa “Zi zhi” petals were extracted. Their concentration and purity were determined by ultraviolet spectrophotometer. Meanwhile, their integrity was detected by 1% agarosegel electrophoresis (Thermo Fisher Scientific, Wilmington, Delaware, USA). The first strand of reverse transcription synthesis cDNA was synthesized by RNA reverse transcription and according to the instructions of abm reverse transcription kit (ABM Company, Vancouver, Canada).</p></sec><sec id="s2_2_2"><title>2.2.2. PCR Cloning of Anthocyanin Biosynthesis Related Gene</title><p>According to the notes of the R. rugosa-transcriptome database, 48 Wd40 genes were isolated and specific primers were designed using Oligo 7.0 software (<xref ref-type="table" rid="table1">Table 1</xref>). The reaction system included 1 &#181;L cDNA, 1 &#181;L F1 primer (10 &#181;mol/L), 1 &#181;L R1 primer (10 &#181;mol/L), and 12.5 &#181;L PCR MIX, with ddH<sub>2</sub>O added to a total volume of 25 &#181;L. The reaction conditions were: 94˚C for 5 min; 94˚C for 30 s, 53˚C for 30 s, and 72˚C for 1 min for a total of 35 cycles; and then extension at 72˚C for 10 min. Next, 1% agarosegel electrophoresis was used to detect the PCR products. The target PCR fragment was recovered with the Hipure Gel Pure DNA Mini Kit (Magen). The recovered fragment was ligated to the pMD18-T vector and then transformed into Escherichia coli DH5α. The positive clones were selected and sent to BGI for sequencing.</p></sec><sec id="s2_2_3"><title>2.2.3. Bioinformatics</title><p>Homologous sequence alignment analysis was performed using Blast online provided by NCBI. The open reading frame for Wd40 gene cDNA was found online, using ORF Finder predict protein secondary structure, using online software Prot-Param and CD-Search was used to analyze the physical and chemical properties of proteins and the prediction of conservative structural domains. Build the phylogenetic tree using MEGA5.0 software.</p></sec><sec id="s2_2_4"><title>2.2.4. Expression Analysis of RrG-Beta1 in Different Tissues and Different Flower Developments</title><p>Following the instruction of SYBR&#174;Premix ExTaqTM kit by CFX96TM Real-Time System RT-qPCR instrument and referencing to abm reverse transcriptase kit to synthesize cDNA and use it as template for real-time fluorescence quantitative PCR method to detect the expression of Wd40 gene in 5 developmental stages and 7 tissue sites. According to the sequence information of Wd40 gene cloned, the primers were designed by using DNAMAN software (<xref ref-type="table" rid="table1">Table 1</xref>). The reaction volume was comprised of 20 ul containing 10 ul SYBR&#174;Premix Ex TaqTM, 0.4 ul primer (RrG-beta1-Q-F and RrG-beta1-Q-R) and 1 ul cDNA, with ddH<sub>2</sub>O added to a total volume of 20 &#181;L. The reaction conditions were as follows: pre-heating at 94˚C for 5 min; 39 cycles at 95˚C for 10 s, at 60˚C for 30 s. Signals were monitored by the Chromo 3 real-time PCR system, finally 30 s at 60˚C and 30 s at 95˚C for the melting curve. Each gene was set to repeat three times, and the experimental data were processed by the method of marking. Each gene was assessed with three biological replications. The relative expression levels of the genes were calculated by the 2<sup>−ΔΔCT</sup> method.</p></sec><sec id="s2_2_5"><title>2.2.5. Construction of Expression Vector</title><p>According to the ORF of RG-beta1, the corresponding primers RrG-beta1-S-F and RrG-beta1-P-R (<xref ref-type="table" rid="table1">Table 1</xref>) were designed. After the sequencing validation, selecting right sequence to extract plasmids, the RrG-beta1 was digested by SpeI and PmlI , and connected to the vector pCAMBIA1304 by Solution-I. The diagram of pCAMBIA1304 was shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>.</p></sec></sec></sec><sec id="s3"><title>3. Results and Analysis</title><sec id="s3_1"><title>3.1. Cloning and Sequence Analysis of RrG-Beta1</title><p>A Wd40 protein was cloned from R. rugosa “Zi zhi” petals, named RrG-beta1. The RrG-beta1 gene 3’ terminal sequence of 262 bp length by using nested PCR method (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)) and the full length of the gene was 981 bp (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)), and the open reading frame was 717 bp, encoding 326 amino acids. We obtained the cDNA of this gene successfully through RNA reverse transcription. The nucleotide sequences by BLAST and the translated amino acid sequences were compared on NCBI, and it was found that the amino acid sequences encoded by RrG-beta1 were as much as 90% homologous with the beta-like proteins of Rosa chinensis, Fragaria, Malus, Pyrus and Prunus. Therefore, it can be inferred that the RrG-beta1 gene is guanine nucleic acid binding to the hypoprotein.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in the present study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >(5’→3’) Nucleotide sequence*</th><th align="center" valign="middle" >Purpose</th></tr></thead><tr><td align="center" valign="middle" >β-F</td><td align="center" valign="middle" >ATGGGTTCCGAAGGCCTC</td><td align="center" valign="middle"  rowspan="2"  >Intermediate segment amplification</td></tr><tr><td align="center" valign="middle" >β-R</td><td align="center" valign="middle" >GAACAATGTGCTTCCATCTGC</td></tr><tr><td align="center" valign="middle" >B<sub>26</sub></td><td align="center" valign="middle" >GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT</td><td align="center" valign="middle"  rowspan="2"  >3’RACE PCR for RrG-beta1</td></tr><tr><td align="center" valign="middle" >β-3’-F</td><td align="center" valign="middle" >GCAGATGGAAGCACATTGTTC</td></tr><tr><td align="center" valign="middle" >RrG-beta1-F</td><td align="center" valign="middle" >ATGGGTTCCGAAGGCCTC</td><td align="center" valign="middle"  rowspan="2"  >Full-length cDNA forRrG-beta1</td></tr><tr><td align="center" valign="middle" >RrG-beta1</td><td align="center" valign="middle" >GGGGAATTGGCCGCTTCTAG</td></tr><tr><td align="center" valign="middle" >Actin-F</td><td align="center" valign="middle" >CACTTAGCACCTTCCAGCAGATGT</td><td align="center" valign="middle"  rowspan="3"  >qRT-PCR forRrG-beta1 and Actin</td></tr><tr><td align="center" valign="middle" >Actin-R</td><td align="center" valign="middle" >CTACAACAGCAGACCTGAGTTCACT</td></tr><tr><td align="center" valign="middle" >RrG-beta1-Q-F</td><td align="center" valign="middle" >ATGAGGGCCCACACCGAC</td></tr><tr><td align="center" valign="middle" >RrG-beta1-Q-R</td><td align="center" valign="middle" >TGAGCTGCCAGAGGATGATG</td><td align="center" valign="middle"  rowspan="3"  >Expression vector constructionforRrG-beta1</td></tr><tr><td align="center" valign="middle" >RrG-beta1-S-F</td><td align="center" valign="middle" >ACTAGTATGGGTTCCGAAGGCCTC</td></tr><tr><td align="center" valign="middle" >RrG-beta1-P-R</td><td align="center" valign="middle" >CACGTGCTAGAAGCGGCCAATTCCCC</td></tr></tbody></table></table-wrap></sec><sec id="s3_2"><title>3.2. Bioinformatics Analysis of RrG-Beta1 Gene</title><p>The RrG-beta1 gene encodes 326 amino acids, and the predicted molecular formula is C<sub>1601</sub>H<sub>2520</sub>N<sub>450</sub>O<sub>486</sub>S<sub>11</sub>, the relative molecular weight is 36201.00 Da, and the theoretical isoelectric PI value is 6.71. Among the 326 amino acids coded, 37 basic amino acids (Arg + Lys) and 38 acidic amino acids (Asp + Glu) are included. Its instability index is 30.44, belonging to the unstable protein; The total average hydrophobic index was −0.847, belonging to hydrophilic protein. The secondary structure of RrG-beta1 demonstrates that there are 17α-helix, 131 random coil, 141 extended peptide chain. The phosphorylation site prediction results reveals that there are 31 Ser phosphorylation sites, 25 Thr phosphorylation sites, and 22 Tyr phosphorylation sites, so we can infer that it may participate in phosphorylation control.</p></sec><sec id="s3_3"><title>3.3. Construction of Plasmid for Transient Gene Expression Assay</title><p>DNAman analysis shows that Rrg-beta1 gene is highly homologous to the Rosa chinensis (xp-024172800), genetic homology with Fragaria (xp-004299548), Malus (xp-008374821), Pyrus (xp-009360100, Prunus (008240184) are respectively 93.59%, 92.99%, 93.29%. RrG-beta1 gene is 85% homologous to RACK Phaseolus vulgaris (ACJ24167), RACK1-like Morus notabilis (ANK58717) and GLRACK1 Glycine max (L.) Merr (q39836). Predicting the conserved domain of Rrg-beta1 protein amino acid sequences, the results showed that the amino acid sequences of Rrg-beta1 protein had typical GH and WD dipeptide structures, in which 7 WD repeats and 7 GH repeats were internal sequences of the protein kinase conserved domain, and their number and location were basically consistent with that soybean, rice and other plants PKC. The N-terminal of the Rrg-beta1 protein is GH and the C-terminal is WG, and the sequences between the sixth and seventh GH-WD core sequences are significantly different from those of other plants, indicating that the protein is significantly different from other homologous proteins (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>In order to study the evolutionary relationship between RrG-beta1 protein and other Wd40 protein, we constructed phylogenetic trees, which showed that RrG-beta1 was closely related to the G-beta familes and RACK families, while it was relatively distant from other Wd40s in different families (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_4"><title>3.4. Expression Analysis of RrG-Beta1 in Different Tissues and Different Flower Developments</title><p>To analyze the specificity of RrG-beta1 gene in different parts and varieties, RT-pcr analysis was used to detect the transcription level of the gene in the root, stem, leaf, petals, pistils, stamens, sepals of the R. rugosa “Zi zhi”. Real-time fluorescence quantitative results of gene RrG-beta1 showed (<xref ref-type="fig" rid="fig5">Figure 5</xref>): the expression of this gene was significantly high in leaves, followed by the expression in petals, slightly expressed in roots, stems and pistils, and almost not expressed in stamens. The expression of this gene in five different periods of R. rugosa “Zi zhi” and R. rugosa “Bai zi zhi” was analyzed. The expression of R. rugosa “Bai zi zhi” was higher than that of Rosa rugosa “Zi zhi” in the bud stage, the initial stage, the blooming stage and the end of the blooming period. Overall, the gene expression of both varieties was the highest at the end of the flowering stage (<xref ref-type="fig" rid="fig6">Figure 6</xref>).</p></sec><sec id="s3_5"><title>3.5. Construction of Plasmid for Transient Gene Expression Assay</title><p>After the expression vector pCAMBIA1304 was cut with the restriction endonuclease with SpeI and PmlI (Firure 4</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>In this study, RrG-beta1 was cloned from Rosa rugosa. G protein beta subunit</p><p>gene is a multifunctional protein that regulates signal transduction, mRNA splicing, and constitutes the cytoskeleton [<xref ref-type="bibr" rid="scirp.88001-ref16">16</xref>] . Through bioinformatics analysis, it was found that RrG-beta1 protein belongs to the Gβ. Gβ has two conservative domains, one is a relatively conservative N-terminal formation of α-helix, which can be nearly parallel and interact with the N-terminal helix of Gβ [<xref ref-type="bibr" rid="scirp.88001-ref17">17</xref>] . Two Cys residues at N terminal can be cross-linked chemically; the other domain consists of seven membrane-like propeller structures composed of seven sets of 40 to 43 repeated fragments of amino acid residues, which contains specific aspartic acid and glycin [<xref ref-type="bibr" rid="scirp.88001-ref18">18</xref>] . It may participate in the regulation of the β and γ combination and adapt to multiple conformation variations of subunits [<xref ref-type="bibr" rid="scirp.88001-ref19">19</xref>] . Therefore, it is concluded that RrG-beta1 protein may be related to cell division and growth development of plant.</p><p>The RrG-beta1 amino acid sequences cloned from Rosa were compared with the amino acid sequences of other species, which shows that RrG-beta1 is more than 90% similar to G protein in Rosa chinensis and Fragaria, and more than 85% similar to RACK1 protein in Arabidopsis , Morus notabilis, etc. Previous studies have shown that RACK1 and G protein genes are highly homologous, and they play a synergistic role in gene function. Gβ protein usually is used as the joint and enzyme regulator of transmembrane signal transduction [<xref ref-type="bibr" rid="scirp.88001-ref20">20</xref>] , while RACK1, as the link of information transmission, transmembrane signal transduction into intracellular signal and transmission of genes from intracellular signal molecules to various regulatory functions [<xref ref-type="bibr" rid="scirp.88001-ref21">21</xref>] . It provides the basis and platform for plant cell division, growth and development, hormone regulation and signal transduction.</p><p>The results of quantitative PCR showed that the expression of RrG-beta1 gene was higher in R. rugosa “Bai zi zhi” than in R. rugosa “Zi zhi”. It has been found that the trimer G protein of RrG-beta1 gene is the physiological regulatory protein of photosensitive pigments. When photosensitive pigments are activated by light, they first activate G protein and then regulate gene expression through a series of intermediates [<xref ref-type="bibr" rid="scirp.88001-ref22">22</xref>] . Through previous studies, it can stimulate the synthesis and effect efficiency of apple photosensitive element by adjusting light to greatly increase the content of anthocyanin in apple fruits, which proves that as the medium between light and anthocyanin, photosensitive element is indirectly related to the synthesis of plant anthocyanin. The fluorescence quantitative results suggested that RrG-beta1 protein might inhibit the synthesis and regulation of photosensitizer, resulting in the reduction of anthocyanin synthesis. In the expression of different tissues of R. rugosa “Zi zhi”, the highest expression is leaves, followed by flowers, pistils and roots. Chen et al. used the split ubiquitin technique to study the mechanism of the response of arabidopsis Gβ and RACK1 to the drought stress signal [<xref ref-type="bibr" rid="scirp.88001-ref23">23</xref>] . All of them can sense the drought stress signal and transmit the signal to the stoma on the leaf, it can control the stoma closure and by stoma conductivity to reduce water loss [<xref ref-type="bibr" rid="scirp.88001-ref24">24</xref>] . Ma li geng et al. first confirmed that G protein was involved in the germination and pollen tube growth of a variety of pollen through a series of pharmacological experiments [<xref ref-type="bibr" rid="scirp.88001-ref25">25</xref>] . The expression level of RrG-beta1 gene in flowers, leaves, pistils and roots is consistent with the results of previous studies, which can be inferred that Gβ gene and RACK1 also play a role in cell signal transduction in Rosa rugosa.</p></sec><sec id="s5"><title>5. Conclusion</title><p>With the development of animal cell signal transduction research, the study of plant cell signal transduction has been paid more and more attention. At present, only G protein related to cell signal transduction has been cloned in the model plants of arabidopsis thaliana and tobacco, and has not been found in flower varieties. In this study, we cloned RrG-beta1 and analyzed its expression, which was beneficial to analyzing the regulation mechanism of plant cell signaling; what is more, it also provided some important information to research drought resistant in Rosa rugosa.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Wang, Y.N., Zhao, M.Y., Han, X., Zhao, L.Y. and Xu, Z.D. (2018) Cloning and Expression Analysis of RrG-Beta1 Gene Related to Anthocyanin Biosynthesis in Rosa rugosa. American Journal of Plant Sciences, 9, 2244-2255. https://doi.org/10.4236/ajps.2018.911162</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.88001-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Buer, C.S., Imin, N., Djordjevic, M.A. and Lucas, W.J. (2010) Flavonoids: New Roles for Old Molecules. Journal of Integrative Plant Biology, 52, 98-111. https://doi.org/10.1111/j.1744-7909.2010.00905.x</mixed-citation></ref><ref id="scirp.88001-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Wenjian, Y.U., Gao, P., Xiong, Y. and Wang, J. (2017) Evaluation and Selection of Adaptability of Twelve Climbing Rose Varieties. Northern Horticulture, 15, 79-83.</mixed-citation></ref><ref id="scirp.88001-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Ben-Simhon, Z., Judeinstein, S., Nadler-Hassar, T., Trainin, T., Bar-Ya’Akov, I., Borochov-Neori, H., et al. (2011) A Pomegranate (Punica granatum L.) WD40-Repeat Gene Is a Functional Homologue of Arabidopsis TTG1, and Is Involved in the Regulation of Anthocyanin Biosynthesis during Pomegranate Fruit Development. Planta, 234, 865-881. https://doi.org/10.1007/s00425-011-1438-4</mixed-citation></ref><ref id="scirp.88001-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Lloyd, A., Brockman, A., Aguirre, L., Campbell, A., Bean, A., Cantero, A., et al. (2017) Advances in the MYB-BHLH-WD Repeat (MBW) Pigment Regulatory Model: Addition of a WRKY Factor and Co-Option of an Anthocyanin MYB for Betalain Regulation. Plant &amp; Cell Physiology, 58, 1431-1441. https://doi.org/10.1093/pcp/pcx075</mixed-citation></ref><ref id="scirp.88001-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Islasflores, T., Guillén, G., Islasflores, I., San, R.C., Sánchez, F., Lozatavera, H., et al. (2009) Germination Behavior, Biochemical Features and Sequence Analysis of the RACK1/arcA Homolog from Phaseolus vulgaris. Physiologia Plantarum, 137, 264-280. https://doi.org/10.1111/j.1399-3054.2009.01280.x</mixed-citation></ref><ref id="scirp.88001-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Sethi, V.P. and Dubey, R.K. (2007) Multi-Rack Tray System for Off-Season Greenhouse Nursery Raising. Journal of Research, 357-363.</mixed-citation></ref><ref id="scirp.88001-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Nitta, Y., Ding, P. and Zhang, Y. (2015) Heterotrimeric G Proteins in Plant Defense against Pathogens and ABA Signaling. Environmental &amp; Experimental Botany, 114, 153-158. https://doi.org/10.1016/j.envexpbot.2014.06.011</mixed-citation></ref><ref id="scirp.88001-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Chakravorty, D., Trusov, Y. and Botella, J.R. (2012) Site-Directed Mutagenesis of the Arabidopsis Heterotrimeric G Protein β Subunit Suggests Divergent Mechanisms of Effector Activation between Plant and Animal G Proteins. Planta, 235, 615-627. https://doi.org/10.1007/s00425-011-1526-5</mixed-citation></ref><ref id="scirp.88001-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Urano, D., Maruta, N., Trusov, Y., Stoian, R., Wu, Q., Liang, Y., et al. (2016) Saltational Evolution of the Heterotrimeric G Protein Signaling Mechanisms in the Plant Kingdom. Science Signaling, 9, ra93. https://doi.org/10.1126/scisignal.aaf9558</mixed-citation></ref><ref id="scirp.88001-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, H., Wang, M., Wang, W., Li, D., Huang, Q., Wang, Y., et al. (2012) Silencing of G Proteins Uncovers Diversified Plant Responses When Challenged by Three Elicitors in Nicotiana benthamiana. Plant Cell &amp; Environment, 35, 72-85. https://doi.org/10.1111/j.1365-3040.2011.02417.x</mixed-citation></ref><ref id="scirp.88001-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Gookin, T.E. and Bendtsen, J.D. (2013). Topology Assessment, G Proein-Coupled Receptor (GPCR) Prediction, and in Vivo Interaction Assays to Identify Plant Candidate GPCRS. G Protein-Coupled Receptor Signaling in Plants, 1043, 1-12. https://doi.org/10.1007/978-1-62703-532-3_1</mixed-citation></ref><ref id="scirp.88001-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Hao, Z.M., Li, Z.Y., Dong, J.G., et al. (2008) Cloning and Expression of the Gene Encoding the G Protein of Maize Big Spotted Bacteria. Journal of Agricultural Biotechnology, 16, 1025-1030.</mixed-citation></ref><ref id="scirp.88001-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Jones, A.M. (2002) G-Protein-Coupled Signaling in Arabidopsis. Current Opinion in Plant Biology, 5, 402-407. https://doi.org/10.1016/S1369-5266(02)00288-1</mixed-citation></ref><ref id="scirp.88001-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Lein, W. and Saalbach, G. (2001) Cloning and Direct G-Protein Regulation of Phospholipase D from Tobacco. BBA—Molecular and Cell Biology of Lipids, 1530, 172-183. https://doi.org/10.1016/S1388-1981(00)00182-7</mixed-citation></ref><ref id="scirp.88001-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ishikawa, A., Iwasaki, Y. and Asahi, T. (1995) Molecular Cloning and Characterization of a cDNA for the α Subunit of a G Protein from Rice. Plant &amp; Cell Physiology, 36, 353-359. https://doi.org/10.1093/oxfordjournals.pcp.a078767</mixed-citation></ref><ref id="scirp.88001-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kaydamov, C., Tewes, A., Adler, K. and Manteuffel, R. (2000) Molecular Characterization of Cdnas Encoding G Protein α and β Subunits and Study of Their Temporal and Spatial Expression Patterns in Nicotiana Plumbaginifolia Viv. Biochimica et Biophysica Acta (BBA)—Gene Structure and Expression, 1491, 143-160. ttps://doi.org/10.1016/S0167-4781(00)00039-7</mixed-citation></ref><ref id="scirp.88001-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Lease, K.A., Wen, J., Li, J., Doke, J.T., Liscum, E. and Walker, J.C. (2001) A Mutant Arabidopsis Heterotrimeric g-Protein Beta Subunit Affects Leaf, Flower, and Fruit Development. Plant Cell, 13, 2631. https://doi.org/10.1105/tpc.13.12.2631</mixed-citation></ref><ref id="scirp.88001-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Trusov, Y., Rookes, J.E., Tilbrook, K., Chakravorty, D., Mason, M.G., Anderson, D., et al. (2007) Heterotrimeric G Protein γ Subunits Provide Functional Selectivity in g β γ Dimer Signaling in Arabidopsis. Plant Cell, 19, 1235-1250. https://doi.org/10.1105/tpc.107.050096</mixed-citation></ref><ref id="scirp.88001-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Rothe, C. and Lehle, L. (1998) Sorting of Invertase Signal Peptide Mutants in Yeast Dependent and Independent on the Signal-Recognition Particle. FEBS Journal, 252, 16-24.</mixed-citation></ref><ref id="scirp.88001-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Dodd, I.C. (2005) Root-to-Shoot Signalling: Assessing the Roles of “Up” in the up and down World of Long-Distance Signalling in Planta. Plant &amp; Soil, 274, 251-270. https://doi.org/10.1007/s11104-004-0966-0</mixed-citation></ref><ref id="scirp.88001-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Ullah, H., Temple, B., Alonso, J.M., Ecker, J.R. and Jones, A.M. (2006) Rack1 Mediates Multiple Hormone Responsiveness and Developmental Processes in Arabidopsis. Journal of Experimental Botany, 57, 2697-2708. https://doi.org/10.1093/jxb/erl035</mixed-citation></ref><ref id="scirp.88001-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Clarke, J.M. and Mccaig, T.N. (1982) Evaluation of Techniques for Screening for Drought Resistance in Wheat. Crop Science, 22, 503-506. https://doi.org/10.2135/cropsci1982.0011183X002200030015x</mixed-citation></ref><ref id="scirp.88001-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Winter, S.R. (1988) Evaluation of Screening Techniques for Breeding Drought-Resistant Winter Wheat. Crop Science, 28, 512-516. https://doi.org/10.2135/cropsci1988.0011183X002800030018x</mixed-citation></ref><ref id="scirp.88001-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Rahman, S., Shaheen, M.S., Rahman, M. and Malik, T.A. (2000) Evaluation of Excised Leaf Water Loss and Relative Water Content, as Screening Techniques for Breeding Drought Resistant Wheat. Pakistan Journal of Biological Sciences, 3, 663-665. https://doi.org/10.3923/pjbs.2000.663.665</mixed-citation></ref><ref id="scirp.88001-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tachibana, M., Wilcox, E., Yokotani, N., Schneider, M. and Fex, J. (1992) Selective Amplification and Partial Sequencing of Cdnas Encoding G Protein Alpha Subunits from Cochlear Tissues. Hearing Research, 62, 82. https://doi.org/10.1016/0378-5955(92)90204-Z</mixed-citation></ref></ref-list></back></article>