<i>MBL2</i> Gene Polymorphism and the Association with Neonatal Sepsis in Egyptian Neonates, a Case Control Study

Mannose binding lectin (MBL) is an important component of innate immunity particularly in neonates whose adaptive immunity is not fully developed. Polymorphism in MBL2 gene promoter and exon1 determines MBL serum level and function. The aim of this study was to investigate the frequency of different MBL2 genotypes in neonatal sepsis among patients of neonatal intensive care unit (NICU). Two hundred and forty-five neonates were enrolled in this study (127 infected and 118 uninfected controls). Multiplex PCR and double amplification refractory mutation system (dARMS) were used for typing of MBL2 exon1 and promoter respectively. Klebsiella species were the most frequently isolated organisms (22.8%). There is no statistical significance difference in the distribution of different expression genotypes between infected group and controls (P = 0.11). However, prevalence of low MBL2 expression genotypes (XA/O and O/O) was higher in infected patients compared to control group (patients 25.2% and controls 15.3%). Low and medium MBL2 expression genotypes were mostly associated with Gram-negative bacterial infections (18.9% and 22.8%) respectively. A statistically significant association of Gram-negative bacterial infections with low MBL2 expression genotypes was found (P = 0.02). Higher frequency of AB and BB genotypes was observed (31.5% and 7.9%) in patients group compared to control, but without statistical significant difference.

• Mannose Binding Lectin (MBL)
• Neonatal Sepsis
• Gene Polymorphism
• Multiplex PCR
• Geneotype
• Haplotype

1. Introduction

Neonatal immunity depends mainly on the innate immune system. Complement factors and acute phase proteins, are important immune system mediators. They are critically important to prevent infections [1] .

Mannose binding lectin (MBL) is a serum protein, produced by liver and involved in innate immunity. It binds to residues on the surface of pathogenic micro-organisms. This results in complement activation and antigens opsonization [2] .

Variations of MBL plasma levels are affected by single nucleotide polymorphisms (SNPs) at promoter and coding segment of MBL2 gene [3] .

MBL2 gene is located on chromosome 10 in the region 10q21-24. The coding segment is composed of four exons. Three functional polymorphisms in exon 1 affect the production of MBL. The common non mutated MBL allele is named A, while the three variant alleles namely “B” (codon 54), “C” (codon 57) and “D” (codon 52) are designated as “O” allele [4] .

It has been proposed that the presence of the O allele weakens the oligomerization of MBL, resulting in diminished levels of functional protein circulating in the serum [5] .

Furthermore, SNPs in the promoter region at positions -550 and -221, known as variations H/L and X/Y respectively, also affect MBL2 expression, although only the X variant significantly reduces MBL serum levels [5] [6] .

Subsequently, the combination of the genetic variation into both exon 1 and promoter results in 3 MBL genotype expression profiles, which are associated with high (YA/YA, YA/XA), medium (XA/XA, YA/O), and low (XA/O, O/O) MBL serum levels [5] - [7] .

The low MBL expression genotypes (XA/O and O/O) [5] [8] , have been associated with a decreased ability of opsonization of microorganisms and an increased susceptibility to infections, mainly in early childhood and in immunocompromised individuals [9] [10] .

Present study was designed to investigate the possible role of polymorphisms of MBL2 gene on the risk of neonatal infections among Egyptian neonates admitted to NICU in Mansoura University Children Hospital.

2. Subject and Method

The study was performed during period extending from January 2013 to August 2015, to investigate infection among neonates admitted to Neonatal Intensive Care Unit (NICU) of Mansoura University Children Hospital. Neonatal infection was diagnosed based on the presence of clinical and microbiological data. The included neonates should have any of the following physical signs: (1) respiratory dysfunction (retractions, grunting, apnea, tachypnea, cyanosis); (2) circulatory dysfunction (tachycardia, bradycardia, delayed capillary refill, hypotension); (3) temperature instability; (4) feeding intolerance; (5) neurologic (lethargy, fits); (6) glucose intolerance [11] . A positive blood culture was required to verify cases with blood stream infection. Pneumonia was defined according to the CDC criteria [12] . Neonates who had no clinical and laboratory signs of infection until discharge were considered as control group. One hundred and twenty-seven infected neonates and 118 uninfected neonates were enrolled in this study.

For all cases and controls, 2 ml blood in EDTA was collected for molecular analysis. In cases of a suspected infection, cultures were performed according to suspected site of infection.

The study protocol was approved by the local medical ethics committee in faculty of medicine, Mansoura University.

Coagulase-negative Staphylococci was reported only when it was detected in two; simultaneously withdrawn; blood culture specimens, together with coexistence of physical signs and laboratory features of sepsis.

2.1. Molecular Techniques

Genomic DNA was extracted from stored blood using QIAamp DNA isolation kit (QIAGEN) according to manufacturer’s instructions.

MBL2 gene promoter polymorphisms (-550 H/L and -221 Y/X) and exon1 polymorphisms (52, 54 and 57) were typed by double amplification refractory system (dARMS) and multiplex PCR respectively according to protocol described previously [13] .

The primer sequences for the promoter genotyping and codon polymorphism are described in Table 1.

Table 1

PCR primers and products of different MBL2 haplotypes/genotypes

Gene region	Reaction No.	Primers	Different haplotypes/ genotypes	PCR product lengths
Promoter	1	L: 5′CTTACCCAGGCAAGCCGGTC3′ + X: 5′GCTGTCTACAAATATCAGAAGGTC3′	LX haplotype	373 bp
	2	L: 5′CTTACCCAGGCAAGCCGGTC3′ + Y: 5′CCTGTCTACAAATATCAGAAGGTC 3′	LY haplotype
	3	H: 5′CTTACCCAGGCAAGCCGGTG3′ + Y: 5′CCTGTCTACAAATATCAGAAGGTC 3′	HY haplotype
1st exon	4	CF: 5′ GCAGCGTCTTACTCAGAAACTGTG3′ + CR: 3′GGGCTGGCAAGACAACTATTAGTC5′ + 52R-D: 3′ACAGTACCGTGGTTCCCTCT5′ + 54R-B: 3′TGTTGTTCCCTCTTTTCCCC5′ + 57R-C: 3′TTCGTTTCCCCCTTGGTCG5′	D/A or D/D	128 + 339 bp
			B/A or B/B	135 + 339 bp
			C/A or C/C	143 + 339 bp
			D/B genotype	128 + 135 + 339 bp
			D/C genotype	128 + 143 + 339 bp
			B/C genotype	135 + 143 + 339 bp
			A/A genotype	339
	5	CF + CR + 52R-ABC: 3′GCAGTACCGTGGTTCCCTCT5′ + 54R-ACD: 3′ CGTTGTTCCCTCTTTCCCC5′ + 57R-ABD: 3′CTCGTTTCCCCCTTGGTCG5′	D/D genotype	135 + 143 + 339 bp
			B/B genotype	128 + 143 + 339 bp
			C/C genotype	128 + 135 + 339 bp
			A/A, A/B, A/C or A/D genotype	128 + 135 + 143 + 339 bp

2.2. PCR Reactions

PCRs reactions were performed as described previously. Briefly, all reactions were initiated by a denaturation step at 95˚C for 3 min, followed by 40 cycles of 30 s at 95˚C, 30 s at 62˚C, and 30 s (in the case of the 1st exon analysis) to 60 s (in case of the promoter genotyping) at 72˚C. Reactions were completed by an extension step at 72˚C for 7 min.

PCR products specific for the particular promoter polymorphisms and the 1^st exon alleles were detected by electrophoresis in 2% agarose or in 4% MetaPhor agarose, respectively. The gels were stained with ethidium bromide and visualized with UV light.

2.3. Statistical Analysis

Statistical analysis was computed on Statistical Package for Social Sciences (SPSS, version 16.00; Chicago, IL, USA). Descriptive statistics were described as mean, standard deviation (s.d), minimum, maximum and percentage. Categorical variables were analyzed using Chi-square test (χ²) or Fisher exact test. High MBL2 expression genotypes were considered as reference group. Kolmogorov-Smirnov test was used to assess normality of continuous variables. Skewed data were analyzed with nonparametric methods (Mann-Whitney test). Values of P < 0.05 were considered to be significant.

3. Results

One hundred and twenty-seven infected neonates and 118 uninfected controls were included in this study. Within the infected group, the mean gestational age was 33.7 wk (range: 27 - 39 wk). The mean gestational age of the control group was 35.3 wk (rang: 28 - 39). Characteristics and clinical diagnosis at admission of patients and control groups are shown in Table 2.

Table 2

Demographic features and clinical diagnosis of patients and control groups

		Patients (number = 127) n (%)	Control (number = 118) n (%)	P value
Sex Male No (%) Female No (%)		62 (48.8) 65 (51.2)	56 (47.5) 62 (52.5)	0.8a
Gestational age Mean ± SD (min - max)		33.7 ± 4.1 (27 - 39)	35.3 ± 2.6 (28 - 39)	0.04b
Prematurity (<37 wk) N (%)		77 (60.6%)	51 (43.2)	0.006c
Clinical diagnosis
Jaundice	7		40
Respiratory distress	46		27
Perinatal infection	33		0
Seizures	12		0
Perinatal asphyxia	10		0
Apnea of prematurity	10		20
Prematurity (for establishment of oral feeding)	9		31

^aComparison of the patients and control group regarding sex distribution; ^bComparison of gestational age in the patients and control group; ^cComparison of prematurity among patients and control group.

Infections detected were blood stream infection and pneumonia. A greater incidence of Gram-negative bacterial infections was detected (67.7%). Klebsiella species were the main cause of both blood stream infection and pneumonia (22.8%) as shown in Table 3.

The DNA samples of 245 neonates (127 infected cases and 118 controls) were analyzed. For each sample, four PCR reactions were done (three for promoter genotyping and one for the detection of mutant allele(s) of the exon 1; reaction No. 1-4 in Table 1). Another PCR reaction was carried out (reaction No. 5 in Table 1) if one mutant allele was detected within exon 1. Regarding exon 1 polymorphism, we refer to the wild type allele as A and the O allele represents D, B, or C alleles [6] [14] .

MBL2 promotor haplotypes and exon1 genotypes of the infected neonates and controls are compared in Table 4.

No significant difference in MBL2 promoter haplotype distribution between patients and control groups (P = 0.8).

The AA genotype was less frequent in patients (47.2%) than in control (56.8%). Whereas, AO and OO genotypes were mostly present in infected groups (52.8%) compared to controls (43.2%). No statistical significant difference was found in distribution of (AA and AO\OO) genotypes between the two groups (P: 0.25).

After determination of MBL2 promoter haplotype and exon 1 genotype, we reconstructed MBL2 combined genotypes. Neonates (both patients and controls) were classified into three groups according to MBL expression levels, namely high (HYA/HYA, HYA/LYA, HYA/LXA, LYA/LYA, and LYA/LXA), medium producers (LXA/LXA, HYA/O, and LYA/O), and low producers (LXA/O and O/O). These combined genotypes were collected into six groups; high producers (YA/YA, YA/XA), medium producers (XA/XA, YA/O), and low producers (XA/O, and O/O) [5] [6] as shown in Table 5 and Table 6.

MBL2 deficient genotypes (XA/O or O/O) were detected in 25.2% of infected neonates and15.3% of control group. No significant difference was found in the distribution of the three MBL2 expression groups between infected patients and the controls (P = 0.11). Regarding the type of infection, low and medium MBL2 expression genotypes were mostly associated with Gram-negative bacterial infections (24/127 and 29/127 representing 18.9% and 22.8%) respectively. The incidence of Gram-negative bacterial infections was statistically significant higher in low MBL2 genotypes than in high expression group (P = 0.042).

Considering exon 1, heterozygous codon 54 (AB) was the most frequent mutant in both infected and control groups (31.5% and 28.8% respectively). Homozygous BB was detected in 7 cases and 5 controls.

Table 3

Causative organisms of neonatal infections

	Blood stream infection (number = 90) n (%)	Pneumonia (number = 37) n (%)	Total = 127 n (%)
Gram-negative bacteria			86 (67.7)
Klebsiella species	22 (24.4)	7 (18.9)	29 (22.8)
E. coli	15 (16.7)	5 (13.5)	20 (15.8)
Acinetobacter species	8 (8.9)	2 (5.4)	10 (7.9)
Enterobacter species	14 (15.6)	1 (2.7)	15 (11.8)
Pseudomonas	8 (8.9)	3 (8.1)	11 (8.7)
Proteus species	1 (1.1)	-	1 (0.8)
Gram-positive bacteria			41 (32.3)
Staphylococcus aureus	12 (13.3)	14 (37.8)	26 (20.5)
Coagulase negative Staphylococci	10 (11.1)	0	10 (7.9)
Streptococcus pneumonae	0	5 (13.5)	5 (3.9)

Table 4

MBL2 gene promotor haplotype, and exon 1 (A/O) genotypes in patients and control groups

	Patients (number = 127)	Control (number = 118)	P value
MBL promoter haplotypes (n) HY LY LX	95 119 40	92 112 32	0.8a
MBL exon 1 (A/O) genotypes, n (%) AA	60 (47.2)	67 (56.8)	0.25b 0.17c
AO AB AD AC	53 (41.7) 40 (31.5) 12 (9.4) 1 (0.8)	43 (36.4) 34 (28.8) 9 (7.6) -	0.43c 0.75c 0.65c 0.43c
OO BB BD DD	14 (11) 10 (7.9) 3 (2.4) 1 (0.8)	8 (6.8) 4 (3.4) 4 (3.4) -	0.27c 0.17c 0.71c 0.43c

^aComparison of MBL2 promoter haplotypes distribution between patients and control groups; ^bComparison of MBL2 exon 1 (AA, AO, OO) genotypes distribution between patients and control groups; ^cComparison of MBL2 exon 1 (A, B, C, D) genotypes distribution between patients and control groups.

4. Discussion

Neonatal sepsis is an important cause of morbidity and mortality. Neonatal sepsis leads to poor neurodevelopmental outcomes especially in preterm [15] . MBL is an important serum protein involved in the innate immune response, as it is able to trigger complement activation [6] . MBL function is much important during the first month of life when the innate immunity is crucial. This to the degree that some researchers recommend MBL as one of biomarker panels for early detection of neonatal sepsis especially in low resource settings [16] .

MBL2 gene polymorphism plays an important role in determination of MBL level [7] .

The present study describes MBL2 genotypes through analysis of the promoter region and exon 1 polymorphism, and comparing the distribution of the genotypes between infected neonates and uninfected control.

This is the first study to search in detailed MBL2 genotypes and susceptibility to infection in neonates in Egypt.

Table 5

MBL2 genotypes grouped according to MBL predicted production in control and infected patients

MBL2 combined genotypes	Control (number = 118) n (%)	Patients (number = 127) n (%)	Patient with Gram negative infection (number = 86) n (%)	Patient with Gram positive infection (number = 41) n (%)
High producer YA\YA, YA\XA	63 (53.4)	55 (43.3)	33 (38.4)	22 (53.7)
Medium producer XA\XA, YA\O	37 (31.3)	40 (31.5)	29 (33.7)	11 (26.8)
Low producer XA\O, O\O	18 (15.3)	32 (25.2)	24 (27.9)	8 (19.5)

Chi-square test was used for comparison of MBL2 genotypes between infected patients and control group: P^a = 0.11, χ² = 4.3; Comparing MBL2 genotypes in patients with Gram-negative bacterial infection to control group P^b = 0.042; χ² = 6.3; Comparing MBL2 genotypes in patients with Gram- positive bacterial infection to control group P^c = 0.8; χ² = 0.5. Considering high MBL producer as reference group: Comparing patients (medium producers) with Gram-negative bacterial infection to control: P = 0.3; χ² = 1.1; Comparing patients (low producers) with Gram-negative bacterial infection to control: P = 0.02; χ² = 5.3; There is a significant association between low MBL genotypes and Gram negative bacterial infections.

Table 6

MBL2 combined genotypes in control and patients groups

MBL2 combined genotypes	Control (number = 118) n (%)	Patients (number = 127) n (%)	P1	Patient with Gram-negative infection (number = 86) n (%)	Patient with Gram-positive infection (number = 41) n (%)	P2
High producer
YA\YA
HYA\HYA	10 (8.4)	9 (7.1)	0.8	4 (4.7)	5 (12.2)	0.1
LYA\LYA	8 (6.8)	9 (7.1)	1	6 (7)	3 (7.3)	1
HYA\LYA	31 (26.3)	25 (19.7)	0.2	15 (17.4)	10 (24.3)	0.5
YA\XA
LYA\LXA	4 (3.4)	3 (2.4)	0.7	3 (3.5)	0	0.6
HYA\LXA	10 (8.5)	9 (7.1)	0.8	5 (5.8)	4 (9.7)	o.5
Medium producer
XA\XA
LXA\LXA	4 (3.4)	5 (3.9)	1	5 (5.8)	0	0.2
YA\O
HYA\HYD	2 (1.7)	3 (2.4)	1	3 (3.5)	0	0.6
HYA\LYB	16 (13.6)	23 (18.1)	0.3	13 (15.1)	10 (24.4)	0.3
HYA\LYC	0	1 (0.8)	1	1 (1.2)	0	1
LYA\HYD	3 (2.5)	1 (0.8)	0.4	0	1 (2.4)	1
LYA\LYB	12 (10.2)	7 (5.5)	0.2	7 (8.1)	0	0.9
Low producer
XA\O
LXA\LYB	6 (5.1)	10 (7.9)	0.4	5 (5.8)	5 (12.2)	0.3
LXA\HYD	4 (3.4)	8 (6.3)	0.4	6 (7)	2 (4.9)	1
O\O
LYB\LYB	4 (3.4)	10 (7.9)	0.2	9 (10.5)	1 (2.4)	0.2
LYB\HYD	4 (3.4)	3 (2.4)	0.7	3 (3.5)	-	0.6
HYD\HYD	0	1 (0.8)	1	1 (1.2)	-	1

Chi-square test and Fisher exact test were used as corresponding for comparison of MBL2 genotypes between infected patients and control; P¹ comparison of combined genotypes between patients and control groups; P² comparison of combined genotypes between patients with Gram-negative and patients with Gram-positive bacterial infections.

In this study we use multiplex PCR which considered as a fast and inexpensive method for the detection of specific DNA sequences. These advantages are especially valuable when there is a need for analysis of a large number of samples and/ or various regions of the gene, which is the case of MBL2 genotyping.

In this study, the most common cause of culture proven neonatal sepsis was Klebsiella species. The rate of infections caused by Gram-positive like Staphylococcus aureus and coagulase negative Staphylococci in our study was much lower. This result is inconstant with many previous results [17] - [19] that reported Staphylococci as the most common cause of neonatal sepsis. However, many studies agreed with our result [20] [21] . This may be due to environmental differences and differences in the supportive care and infection control practices between different centers.

In our study, analysis of exon 1 mutant allele frequencies showed that O alleles (AO and OO) were mostly found in infected neonates (52%), however this difference is not statistically significant. Allele B both heterozygous (AB) and homozygous (BB) was the commonest mutant allele encountered in neonatal sepsis (39.4%). Similar results were obtained by Özkan et al., Dzwonek et al. and Roy et al. [22] - [24] . However, other studies like Ahrens et al. and Auriti et al. [25] [26] disagree with our result.

Considering combined MBL2genotypes, low MBL2 producing genotypes were more frequent in infected neonates compared to control group without statistical significant difference. This result somewhat agrees with the result obtained by Ozkan et al. [22] who found low producing MBL2 genotypes are significant risk factor for neonatal sepsis in Turkish neonates. Other studies like Frakking et al. [27] obtain different results, as they found no relation between the MBL2 gene polymorphism and neonatal sepsis. This discrepancy of results may be explained by different sample size and the variable distribution of MBL2 genotyped in the study population. In addition to the different methods that were used for the diagnosis of neonatal sepsis in other studies.

MBL binds to the mannose-enriched portion of lipopolysaccharide of Gram-negative organisms through carbohydrate recognition domain (CRD) and its binding mediates lectin―complement pathway activation. Complement activation kills Gram-negative organisms either directly via the membrane-attack complex or by enhancing complement mediated phagocytosis through the increased deposition of opsonic C3 fragments [28] [29] .

In this study, incidence of Gram-negative bacterial infections was statistically significant higher among patients expressing low-MBL-producing genotypes. Our results consistent with results obtained by Pehlivan et al. [30] which show that Gram-negative bacteremia was more common in deficient MBL2 AB/BB genotype. However our result inconsistent with study by Hellemann et al. [31] in critically ill patients admitted to an intensive care, which reported an association of low MBL2 O/O genotype with an increased incidence of Gram-positive infections. Other study performed by Klostergaard et al. [32] didn’t find any association between MBL2 polymorphism and the type of bacterial sepsis. The diversity between the different studies may be explained by fact that MBL also acts as a scavenger molecule in maintaining internal tissue homeostasis. Apparent MBL associations may be due to disturbances in this scavenger system, rather than a direct anti-infectious effect [33] .

Our study has some limitations. First we didn’t investigate the other risk factors for neonatal infection. Also, we didn’t measure the serum level of MBL as there is no consensus definition for the neonatal MBL deficiency. Lastly, our study didn’t search the possible relation of preterm neonates with MBL2 polymorphism. So we recommend further studies to investigate the relation of low MBL producing genotypes to other risk factors for neonatal Gram-negative bacterial infection.

5. Conclusion

Low (LXA/O and O/O) and medium (XA\XA and YA\O) MBL producers are more frequently encountered in patients with neonatal sepsis than in control group. The low producing genotypes represent significant risk factor for developing Gram-negative bacterial infections in neonates.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

References

1. Strunk, T. and Burgner, D. (2006) Genetic Susceptibility to Neonatal Infection. Current Opinion in Infectious Diseases, 19, 259. http://dx.doi.org/10.1097/01.qco.0000224820.19858.7a

2. Neth, O., Jack, D.L., Dodds, A.W. and Holzel, H. (2000) Mannose-Binding Lectin Binds to a Range of Clinically Relevant Microorganisms and Promotes Complement Deposition. Infection and Immunity, 68, 688-693.http://dx.doi.org/10.1128/IAI.68.2.688-693.2000

3. Monticielo, O.A., Mucenic, T., Xavier, R.M., Brenol, J.C. and Chies, J.A. (2008) The Role of Mannose Binding Lectin in Systemic Lupus Erythematosus. Clinical Rheumatology, 27, 413-419. http://dx.doi.org/10.1007/s10067-008-0838-8

4. Garred, P., Larsen, F., Madsen, H.O. and Koch, C. (2003) Mannose-Binding Lectin Deficiency-Revisited. Molecular Immunology, 40, 73-84. http://dx.doi.org/10.1016/S0161-5890(03)00104-4

5. Madsen, H.O., Garred, P., Thiel, S., Kurtzhals, J.A., Lamm, L.U., Ryder, L.P. and Svejgaard, A. (1995) Interplay between Promoter and Structural Gene Variants Control Basal Serum Level of Mannan-Binding Protein. Journal of Immunology, 155, 3013-3020.

6. Turner, M.W. (2003) The Role of Mannose-Binding Lectin in Health and Disease. Molecular Immunology, 40, 423-429. http://dx.doi.org/10.1016/S0161-5890(03)00155-X

7. Frakking, F.N., Brouwer, N., Zweers, D., Merkus, M.P., Kuijpers, T.W., Offringa, M. and Dolman, K.M. (2006) High Prevalence of Mannose-Binding Lectin (MBL) Deficiency in Premature Neonates. Clinical & Experimental Immunology, 145, 5-12. http://dx.doi.org/10.1111/j.1365-2249.2006.03093.x

8. Garred, P., Madsen, H.O., Halberg, P., Petersen, J., Kronborg, A.S., Svejgaard, A., Andersen, V. and Jacobsen, S. (1999) Mannose-Binding Lectin Polymorphisms and Susceptibility to Infection in Systemic Lupus Erythematosus. Arthritis & Rheumatology, 42, 2145-2152. http://dx.doi.org/10.1002/1529-0131(199910)42:10<2145::AID-ANR15>3.0.CO;2-#

9. Koch, A., Melbye, M., Sorensen, P., Homoe, P., Madsen, H.O., Molbak, K., Hansen, C.H., Andersen, L.H., Hahn, G.W. and Garred, P. (2001) Acute Respiratory Tract Infections and Mannose-Binding Lectin Insufficiency during Early Childhood. JAMA, 285, 1316-1321. http://dx.doi.org/10.1001/jama.285.10.1316

10. Summerfield, J.A., Sumiya, M., Levin, M. and Turner, M.W. (1997) Association of Mutations in Mannose Binding Protein Gene with Childhood Infection in Consecutive Hospital Series. BMJ, 314, 1229-1232.http://dx.doi.org/10.1136/bmj.314.7089.1229

11. Haque, K.N. (2005) Definitions of Bloodstream Infection in the Newborn. Pediatric Critical Care Medicine, 6, S45-S49. http://dx.doi.org/10.1097/01.pcc.0000161946.73305.0a

12. Horan, T.C., Andrus, M. and Dudeck, M.A. (2008) CDC/NHSN Surveillance Definition of Health Care Associated Infection and Criteria for Specific Types of Infections in the Acute Care Setting. American Journal of Infection Control, 36, 309-332. http://dx.doi.org/10.1016/j.ajic.2008.03.002

13. Skalnikova, H., Freiberger, T., Chumchalova, J., Grombirikova, H. and Sediva, A. (2004) Cost Effective Genotyping of Human MBL2 Gene Mutations Using Multiplex PCR. Journal of Immunological Methods, 295, 139-147.http://dx.doi.org/10.1016/j.jim.2004.10.007

14. Garred, P., Larsen, F., Seyfarth, J., Fujita, R. and Madsen, H.O. (2006) Mannose-Binding Lectin and Its Genetic Variants. Genes & Immunity, 7, 85-94. http://dx.doi.org/10.1038/sj.gene.6364283

15. Mitha, A., Foix-L’Hélias, L., Arnaud, C., Marret, S., Vieux, R., Aujard, Y., Thiriez, G., Larroque, B., Cambonie, G., Burguet, A., Boileau, P., Rozé, J.C., Kaminski, M., Truffert, P. and Ancel, P.Y., EPIPAGE Study Group (2013) Neonatal Infection and 5-Year Neurodevelopmental Outcome of Very Preterm Infants. Pediatrics, 132, e372-e380. http://dx.doi.org/10.1542/peds.2012-3979

16. Wagner, T.A., Gravett, C.A., Healy, S., Soma, V., Patterson, J.C., Gravett, M.G. and Rubens, C.E. (2011) Emerging Biomarkers for the Diagnosis of Severe Neonatal Infections Applicable to Lowresource Settings. Journal of Global Health, 1, 210-223.

17. Chapagain, R.H., Acharya, R., Shrestha, N., Giri, B.R., Bagale, B.B. and Kayastha, M. (2015) Bacteriological Profile of Neonatal Sepsis in Neonatal Intermediate Care Unit of Central Paediatric Referral Hospital in Nepal. Journal of Nepal Health Research Council, 13, 205-208.

18. Jiang, Y., Kuang, L., Wang, H., Li, L., Zhou, W. and Li, M. (2016) The Clinical Characteristics of Neonatal Sepsis Infection in Southwest China. Internal Medicine, 55, 597-603. http://dx.doi.org/10.2169/internalmedicine.55.3930

19. Rohit, A., Maiti, B., Shenoy, S. and Karunasagar, I. (2016) Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) for Rapid Diagnosis of Neonatal Sepsis. Indian Journal of Medical Research, 143, 72-78.http://dx.doi.org/10.4103/0971-5916.178613

20. Muley, V.A. and Ghadage, D.P. (2015) Bacteriological Profile of Neonatal Septicemia in a Tertiary Care Hospital from Western India., Bhore AV1. Journal of Global Infectious Diseases, 7, 75-77. http://dx.doi.org/10.4103/0974-777X.154444

21. Dramowski, A., Madide, A. and Bekker, A. (2015) Neonatal Nosocomial Bloodstream Infections at a Referral Hospital in a Middle-Income Country: Burden, Pathogens, Antimicrobial Resistance and Mortality. Paediatrics and International Child Health, 35, 265-272. http://dx.doi.org/10.1179/2046905515Y.0000000029

22. Ozkan, H., Koksal, N., Cetinkaya, M., Kilic, S., Celebi, S., Oral, B. and Budak, F. (2012) Serum Mannose-Binding Lectin (MBL) Gene Polymorphism and Low MBL Levels Are Associated with Neonatal Sepsis and Pneumonia. Journal of Perinatology, 32, 210-217. http://dx.doi.org/10.1038/jp.2011.79

23. Dzwonek, A.B., Neth, O.W., Thiébaut, R., Gulczynska, E., Chilton, M., Hellwig, T., Bajaj-Elliott, M., Hawdon, J. and Klein, N.J. (2008) The Role of Mannose-Lectin Binding in Susceptibility to Infection in Preterm Neonates. Pediatric Research, 63, 680-685. http://dx.doi.org/10.1203/PDR.0b013e31816fdbff

24. Roy, S., Knox, K., Segal, S., Griffiths, D., Moore, C.E., Welsh, K.I., Smarason, A., Day, N.P., McPheat, W.L., Crook, D.W., Hill, A.V. and Oxford Pneumoccocal Surveillance Group (2002) MBL Genotype and Risk of Invasive Pneumococcal Disease: A Case-Control Study. Lancet, 359, 1569-1573. http://dx.doi.org/10.1016/S0140-6736(02)08516-1

25. Ahrens, P., Kattner, E., Kohler, B., Hartel, C., Seidenberg, J., Segerer, H., Moller, J., Gopel, W. and Genetic Factors in Neonatology Study Group ( 2004) Mutations of Genes Involved in the Innate Immune System as Predictors of Sepsis in Very Low Birth Weight Infants. Pediatric Research, 55, 652-656. http://dx.doi.org/10.1203/01.PDR.0000112100.61253.85

26. Auriti, C., Prencipe, G., Inglese, R., Azzari, C., Ronchetti, M.P., Tozzi, A., Seganti, G., Orzalesi, M. and De Benedetti, F. (2010) Role of Mannose-Binding Lectin in Nosocomial Sepsis in Critically Ill Neonates. Human Immunology, 71, 1084-1088. http://dx.doi.org/10.1016/j.humimm.2010.08.012

27. Frakking, F.N., Brouwer, N., van Eijkelenburg, N.K., Merkus, M.P., Kuijpers, T.W., Offringa, M. and Dolman, K.M. (2007) Low Mannose-Binding Lectin (MBL) Levels in Neonates with Pneumonia and Sepsis. Clinical and Experimental Immunology, 150, 255-262. http://dx.doi.org/10.1111/j.1365-2249.2007.03479.x

28. Schlapbach, L.J., Mattmann, M., Thiel, S., Boillat, C., Otth, M., Nelle, M., Wagner, B., Jensenius, J.C. and Aebi, C. (2010) Differential Role of the Lectin Pathway of Complement Activation in Susceptibility to Neonatal Sepsis. Clinical Infectious Diseases, 51, 153-162. http://dx.doi.org/10.1086/653531

29. Jack, D.L., Klein, N.J. and Turner, M.W. (2001) Mannose-Binding Lectin: Targeting the Microbial World for Complement Attack and Opsonophagocytosis. Immunological Reviews, 180, 86-99. http://dx.doi.org/10.1034/j.1600-065X.2001.1800108.x

30. Pehlivan, M., Sahin, H.H., Ozdilli, K., Onay, H., Ozcan, A., Ozkinay, F. and Pehlivan, S. (2014) Gene Polymorphisms and Febrile Neutropenia in Acute Leukemia—No Association with IL-4, CCR-5, IL-1RA, but the MBL-2, ACE, and TLR-4 Are Associated with the Disease in Turkish Patients: A Preliminary Study. Genetic Testing and Molecular Biomarkers, 18, 474-481. http://dx.doi.org/10.1089/gtmb.2014.0004

31. Hellemann, D., Larsson, A., Madsen, H.O., Bonde, J., Jarlov, J.O., Wiis, J., Faber, T., Wetterslev, J. and Garred, P. (2007) Heterozygosity of Mannose-Binding Lectin (MBL2) Genotypes Predicts Advantage (Heterosis) in Relation to Fatal Outcome in Intensive Care Patients. Human Molecular Genetics, 16, 3071-3080. http://dx.doi.org/10.1093/hmg/ddm265

32. Klostergaard, A., Steffensen, R., Moller, J.K., Peterslund, N., Juhl-Christensen, C. and Molle, I. (2010) Sepsis in Acute Myeloid Leukaemia Patients Receiving High-Dose Chemotherapy: No Impact of Chitotriosidase and Mannose-Binding Lectin Polymorphisms. European Journal of Haematology, 85, 58-64. http://dx.doi.org/10.1111/j.1600-0609.2010.01443.x

33. Nauta, A.J., Raaschou-Jensen, N., Roos, A., Daha, M.R., Madsen, H.O., Borrias-Essers, M.C., Ryder, L.P., Koch, C. and Garred, P. (2003) Mannose-Binding Lectin Engagement with Late Apoptotic and Necrotic Cells. European Journal of Immunology, 33, 2853-2863. http://dx.doi.org/10.1002/eji.200323888