<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2023.147051</article-id><article-id pub-id-type="publisher-id">AJPS-126446</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  &lt;i&gt;Cucurbita ficifolia&lt;/i&gt; Bouch&#233; Regulates the Metabolism of Carbohydrates and Lipids in Liver by Activation of PPAR&lt;i&gt;α&lt;/i&gt; without Affectation on PPAR&lt;i&gt;γ in Vivo&lt;/i&gt; and &lt;i&gt;in Vitro&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Julio</surname><given-names>Cesar Almanza-Perez</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Vladimir</surname><given-names>Hernandez-Rosado</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Angeles</surname><given-names>Fortis-Barrera</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Gerardo</surname><given-names>Blancas-Flores</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Edgar</surname><given-names>Alarcon-Villaseñor</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jose</surname><given-names>Luis Flores-Saenz</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wendoline</surname><given-names>Rosiles-Alanis</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Francisco</surname><given-names>Javier Alarcon-Aguilar</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Pharmacology Laboratory, Department of Health Sciences, Division of Biological and Health Sciences, Metropolitan Autonomous University, Mexico City, Mexico</addr-line></aff><aff id="aff2"><addr-line>Adyderma Medical International Institute, Mexico City, Mexico</addr-line></aff><pub-date pub-type="epub"><day>19</day><month>07</month><year>2023</year></pub-date><volume>14</volume><issue>07</issue><fpage>763</fpage><lpage>781</lpage><history><date date-type="received"><day>27,</day>	<month>May</month>	<year>2023</year></date><date date-type="rev-recd"><day>18,</day>	<month>July</month>	<year>2023</year>	</date><date date-type="accepted"><day>21,</day>	<month>July</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Diabetes mellitus control in Mexico is practiced by using antidiabetic agents and, by empirical way using medicinal plants. 
  Cucurbita 
  ficifolia (
  C. 
  ficifolia) has been attributed with hypoglycemic, hypotriglyceridemic, and anti-inflam
  - 
  matory effects, and D-chiro-inositol (DCI), 4-hydroxybenzoic acid, and β-sitosterol were proposed as active principles. The last two compounds were suggested as activators of two transcription factors, PPARα and PPARγ, in C2C12 myocytes, which participate in β-oxidation of fatty acids and insulin sensitivity. However, the involvement of the hepatocytic and adipocytic PPARs in the effects of C. ficifolia has not yet been explored. This research aimed to determine the effects of C. ficifolia on PPARα, PPARγ, and inflammatory cytokines in streptozotocin (STZ)-induced diabetes mice, HepG2 hepatocytes and 3T3-L1 adipocytes, implicating two additional cell types associated with metabolism of carbohydrates and lipids. STZ-induced diabetes mice received C. ficifolia (200 mg/kg/day) for 30 days, measuring serum cytokines (TNF-α and IL-6). RNA was extracted from liver. Besides, HepG2 and 3T3-L1 cells were incubated (24 h) with C. ficifolia (0.078 mM DCI), using pioglitazone or fenofibrate as controls. RNA was also extracted from cells and PCR in real-time was performed to determinate PPARα and PPARγ expression. In diabetic animals, C. ficifolia decreased glycemia and body weight, decreasing the expression level of TNF-α and IL-6. In addition, C. ficifolia increased PPARα expression in liver of diabetic animals, in HepG2 and 3T3-L1 cells; PPARγ expression only significantly increased in HepG2 cells. The data suggest that the effects on the glycemia and lipids of C. ficifolia and its anti-inflammatory effects imply, besides skeletal muscle cells, hepatic and adipocytic PPARα activation, without affectation on PPARγ. PPARs regulation by C. ficifolia may improve the metabolic dysfunctions associated with metabolic disease, controlling the intake, activation, and oxidation of fatty acids and lipid storage.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Cucurbita ficifolia&lt;/i&gt;</kwd><kwd> Diabetes Mellitus</kwd><kwd> Hypoglycemic Plants</kwd><kwd>  Anti-Inflammatory Plants</kwd><kwd> PPARs</kwd><kwd> PPAR&lt;i&gt;α&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Cucurbita ficifolia Bouch&#233; (Cucurbitaceae) is an annual plant whose edible fruits have been attributed with medicinal properties. Several experimental and clinical studies have validated its biological effects. The hypoglycemic effect of the aqueous extract of the fruit was demonstrated in healthy and diabetic rabbits, mice, and rats, as well as in human diabetic patients [<xref ref-type="bibr" rid="scirp.126446-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref2">2</xref>] . Then, it was reported its secretagogue action of insulin in RINm5F cells, which depends on the influx of Ca<sup>2+</sup> from endoplasmic reticulum, an independent mechanism of sulphonylureas mediated by K<sup>+</sup> channels dependent on ATP [<xref ref-type="bibr" rid="scirp.126446-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref4">4</xref>] . Furthermore, a liver histological analysis in alloxan-induced diabetes mice showed an accumulation of glycogen mediated by an increase in glycogen synthase and a decrease in glycogen phosphorylase [<xref ref-type="bibr" rid="scirp.126446-ref5">5</xref>] . Interestingly, the histological architecture evidenced a liver-protective effect due to the extract [<xref ref-type="bibr" rid="scirp.126446-ref5">5</xref>] .</p><p>Since type 2 diabetes mellitus patients present situations of oxidative stress, dyslipidemia, and chronic inflammation, the antioxidant, and anti-inflammatory effects of fruit C. ficifolia aqueous extract were studied in streptozotocin (STZ)-induced diabetes mice [<xref ref-type="bibr" rid="scirp.126446-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref7">7</xref>] and 3T3-L1 adipocytes [<xref ref-type="bibr" rid="scirp.126446-ref8">8</xref>] . In consequence, fruit C. ficifolia aqueous extract was proposed as a cytokine’s inflammatory modulator, which was confirmed in monosodium glutamate-induced obesity mice, increasing the expression of IFN-γ and IL-10, whereas decreasing the expression of IL-6, TNF-α, and resistin, without changes in adiponectin’s expression [<xref ref-type="bibr" rid="scirp.126446-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref9">9</xref>] .</p><p>Concerning the phytochemistry of C. ficifolia fruit, in 2006, Xia and Wang proposed D-chiro-inositol (DCI) as one of the responsible principles of the hypoglycemic effect of C. ficifolia [<xref ref-type="bibr" rid="scirp.126446-ref10">10</xref>] . Other identified secondary metabolites in the extracts of the fruit were phytosterols and fatty acids: β-sitosterol was the most abundant component, followed by 1,3-dimethyl-3-hydroxy-5-methoxyoxindole, 2H-1,4-benzoxazin-3(4H)-one, 2-butyl-4-hydroxy, 3-[(3,5-dimethoxybenxoyl)hydrazono]-N-(2-methoxyethyl)butyramide, 4-cyano-4-hydroxy-3-methyl-2-phenylpiperidine, stigmast-7-en-3-ol, benzoic acid, undecyl ester, stigmasta-5,24(28)-dien-3-ol, and stigmasta-5,22-dien-ol [<xref ref-type="bibr" rid="scirp.126446-ref11">11</xref>] . Also identified were the 4-hydroxy-benzoic acid, hydroxyphenyl acetic acid, gallic acid, salicin, catechin, p-coumaric acid, and cinnamic acid. In these studies, β-sitosterol and 4-hydroxybenzoic acid were pharmacologically evaluated [<xref ref-type="bibr" rid="scirp.126446-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref11">11</xref>] . Both compounds increased insulin secretion in RINm5F cells, probably mediated by the receptors G-protein coupled receptor 40 (GPR40) and increased the activation of one member of the family of peroxisome proliferator-activated receptors (PPARs), PPARγ in C2C12 myocytes [<xref ref-type="bibr" rid="scirp.126446-ref11">11</xref>] .</p><p>Although the aqueous extract from fruit of C. ficifolia has hypoglycemic, hypolipidemic, antioxidant, and anti-inflammatory actions, little is known about its effects on the energetic balance regulated by the peroxisome proliferator-activated receptors (PPARs), which play an essential role in all these actions in key metabolic tissue as liver and adipose tissue. PPARs are transcription factors, members of the nuclear hormone receptor superfamily that regulate carbohydrates and lipids’ metabolism [<xref ref-type="bibr" rid="scirp.126446-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref13">13</xref>] Three PPARs subtypes have been described (α, γ, and β/Δ), which possess differential tissue distribution and selective ligands [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . PPARα is expressed notably in hepatocytes, whereas PPARγ is expressed mainly in adipocytes; PPAR β/Δ is more ubiquitous and is mainly expressed in adipose tissue and skeletal muscle.</p><p>PPARα activation in the liver plays an essential role in controlling fatty acid transport, β-oxidation, and the expression of proteins, such as long-chain-fattyacid-CoA ligase 1 (ACSL-1), also participating in the inflammatory response [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . In diabetes, PPARα in the liver is deregulated, contributing to hyperglycemia and accumulating fatty acids, inflammation, and fibrosis [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . PPARγ activation in adipocytes increases GLUT-4 and fat accumulation, thereby increasing adiponectin and decreasing resistin and TNF-α expression, enhancing insulin sensitivity and reducing glycemia [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] PPARγ also regulates immunity and inflammation through adipokines, particularly adiponectin, whose secretion occurs in adipose tissue and skeletal muscle [<xref ref-type="bibr" rid="scirp.126446-ref15">15</xref>] .</p><p>Since, in different experimental conditions, the aqueous extract from fruit of C. ficifolia has shown hypoglycemic, hypolipidemic, and anti-inflammatory actions [<xref ref-type="bibr" rid="scirp.126446-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref9">9</xref>] , the present research aimed to determine if this extract regulates these effects by activation of PPARα and PPARγ in liver and adipocyte tissue using approaching studies in vivo (STZ-induced-diabetes mice) and in vitro (HepG2 and 3T3-L1 cells).</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Plant Material</title><p>Fresh mature fruits of C. ficifolia (18 - 20 cm of diameter) were gathered from the Acolman Municipality, Estado de Mexico, in April and May. This material was identified by taxonomic keys and was compared with voucher specimen No. 11119 from the Medicinal Plant Herbarium of the Mexican Institute of Social Security at Mexico City (Herbarium IMSS-M). The seedless endocarp was dried at room temperature and ground using 2-mm mesh in a Model 4 Wiley electric mill.</p></sec><sec id="s2_2"><title>2.2. Preparation of Aqueous Extract from C. ficifolia Fruit</title><p>The aqueous extract was obtained following the methodology of previous studies [<xref ref-type="bibr" rid="scirp.126446-ref2">2</xref>] . The ground material (100 g) from the C. ficifolia fruit was extracted with 300 mL of water for 24 h, at ambient temperature. This extract was filtered and freeze-dried, resulting in an aqueous extract yielding 35%.</p></sec><sec id="s2_3"><title>2.3. Quantitative Analysis of D-Chiro-Inositol in the Aqueous Extract of C. ficifolia</title><p>An isocratic acetonitrile-methanol (8:2) mixture was used for elution over a LiChrospher 100 &#197; NH<sub>2</sub> column (5 μm, 4 &#215; 250 mm). D-chiro-inositol was quantified using high-performance liquid chromatography (HPLC; Waters 2695 separation module) with a Waters 2697 Index Refractive Detector (Waters Milford, MA, USA). The concentration of D-chiro-inositol, which had a retention time of 8.6 min, was determined upon injection of the extract (20 &#181;L/2mg/mL). The resulting standard curve was linear (R<sup>2</sup> = 0.99); the aqueous extract of C. ficifolia contained 3.32 mg of D-chiro-inositol/g of extract.</p></sec><sec id="s2_4"><title>2.4. Experimental Animals</title><p>Male CD-1 mice (30 - 35 g) were obtained from the Laboratory Animal Center of the Metropolitan Autonomous University. They were maintained with rodent food (Harlan Laboratories, Indianapolis, USA) and water ad libitum under a 12 h light/dark cycle. All rodent procedures followed International Rules for the Care and Use of Laboratory Animals, in agreement with the Mexican Official Norm (NOM-062-ZOO-1999, revised 2001).</p></sec><sec id="s2_5"><title>2.5. Evaluation of the Energetic Balance and Anti-Inflammatory Effect of the Aqueous Extract from Fruit of C. ficifolia</title><p>Considering that the aqueous extract from fruit of C. ficifolia can be used as prophylactic and curative treatments, we considered both stages in the experimental design. Normal mice were divided into four groups of 6 animals each. Groups 1 and 2 received saline solution (4 mL/kg/day), Group 3 received aqueous extract of C. ficifolia (200 mg/kg/day), and Group 4 pioglitazone (45 mg/kg/day), an insulin-sensitizer that activates PPARγ [<xref ref-type="bibr" rid="scirp.126446-ref16">16</xref>] or, in its case fenofibrate (100 μM) as a PPARα activator. The dose of 200 mg/kg/day of the aqueous extract of C. ficifolia used in the in vivo experiment was chosen of previous studies [<xref ref-type="bibr" rid="scirp.126446-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref11">11</xref>] . These agents were used as potential preventive treatments, which were given by gavage for 15 days. Afterward, Groups 2, 3, and 4 received a single intraperitoneal administration of 137 mg/kg streptozotocin (STZ) dissolved in citrate buffer (0.1 M, pH = 4.5). Group 1 received citrate buffer only. All treatments were continued for the other 30 days after administration of STZ.</p></sec><sec id="s2_6"><title>2.6. Biochemical Parameters and Cytokine Quantification</title><p>Body weight, triglycerides, and glycemia were measured throughout the experiment. The biomarkers of inflammation were quantified at the end of the treatments. Glycemia was determined in blood samples from a puncture of the tail vein and was quantified on the 15th day in normal mice with free access to water and food and on day 45 in fasted animals (12 h without food) using the hydrogenase method (Roche Diagnostics). On day 45, quantification of triglycerides was performed in Reflotron System (Bayer), using blood samples from the ocular orbital sinus of animals anesthetized with pentobarbital (200 mg/kg). At the end of the study (30 days after STZ administration), additional blood samples were obtained from the ocular orbital sinus for cytokine analysis. Serum cytokine levels were quantified using enzyme-linked immunosorbent assay (ELISA) kits purchased, IL-6 was analyzed from Pierce Protein Research Products (Thermo Fisher Scientific, Illinois, USA) and TNF-α from R &amp; D Systems (Minneapolis, USA). The RNA was isolated from the liver by using a Trizol reagent (ThermoFisher Scientific, MA, USA). The RNA (1 μg) was electrophoresed using a 1% agarose gel, stained with ethidium bromide, and visualized using the Image Gel-Logic 212 Pro (Kodak/Carestream, Rochester, NY, USA). To confirm the integrity of RNA, absorbance at 260 and 280 nm was measured for each RNA sample; the OD ratio (260/280 nm) was 1.9 &#177; 0.2, consistent with the absence of protein contamination. Two major ribosomal bands (28S and 18S rRNA) without RNA degradation were detected (data not shown).</p></sec><sec id="s2_7"><title>2.7. HepG2 and 3T3-L1 Cells Culture</title><p>HepG2 cellular line of human hepatoblastoma was acquired from American Type Culture Collection (ATCC, Rockville, MD, USA). These cells were maintained in Williams medium (Sigma, St Louis, MO) supplemented with fetal bovine serum at 8% (FBS, Hy-Clone, Logan, UT, USA), 100 U/mL penicillin, and 100 μL streptomycin (Micro lab). Cells were grown in plastic bottles in sterile conditions (Corning, Tewksbury, MA, USA), changing the medium each 48 h. Trypsinized cells (trypsin 0.25% and EDTA 0.2 M (Sigma)) were diluted and cultured weekly 1:3 in culture bottles. Culture cells were incubated in 5% CO<sub>2</sub>, 95% moisture, and a temperature of 37˚C. All experiments were performed in the logarithmic phase of cell growth. HepG2 cells were treated for 24 h with the aqueous extract of C. ficifolia (containing 0.078 mM of DCI), using as positive controls pioglitazone or fenofibrate. After 24 h of treatment, RNA was extracted from culture cells by the Trizol method. From extracted RNA, the cDNA and PCR in real-time were performed.</p><p>The 3T3-L1 cells of mice fibroblasts were cultures in Eagle modified medium Dulbecco (DMEM, GIBCO, Grand Island, NY, USA) with 10% calf serum and glucose 25.5 mM, in culture bottles of 75 cm at 37˚C, 5% de CO<sub>2</sub> and 95% humidity. These cells in preadipocyte conditions were differentiated into adipocytes. The 3T3-L1 mice fibroblasts (8 &#215; 10<sup>5</sup> cells/well) were cultivated at the confluence in the same conditions (37˚C, 5% CO<sub>2</sub>), glucose 25.5 mM, sodium pyruvate 1 mM, glutamine 2 mM, non-essential amino acids (0.1 mM), gentamicin (20 μg/mL), and complemented with 10% of FBS. After two days of confluence (day 0), the differentiation was induced with metil-hydroxybutylxanthine (MIX, 0.5 mM), dexamethasone (DX, 0.25 μM), and insulin (5 μg/mL) in DMEM with 10% FBS. On the second day, the medium was changed and added with insulin (5 μg/mL), free of MIX and DX, incubating for another two days. From the fourth day, medium free of insulin was replaced each 48 h. Cells were used after eight days of differentiation [<xref ref-type="bibr" rid="scirp.126446-ref17">17</xref>] .</p><p>The 3T3-L1 cells were incubated for 24 h with the aqueous extract of C. ficifolia (containing 0.78 mM of DCI) and the positive controls (10 μM pioglitazone and 100 μM fenofibrate). After 24 h of treatment, RNA was extracted from the cells by the Trizol method. From RNA was prepared, the cDNA and PCR in real-time were performed.</p></sec><sec id="s2_8"><title>2.8. mRNA Expression of PPARγ, PPARα, TNF-α, and IL-6</title><p>Two micrograms of total RNA were reverse transcribed using the ImProm II reverse transcription system (Promega, Madison, WI, USA). The reaction (20 μL) was incubated in a thermocycler Select Cycler (BioProducts, West Palm Beach, FL, USA), following the next cycle program: incubation for 5 min at 25˚C, extension at 42˚C for 55 min, the enzyme was inactivated at 70˚C for 15 min, and lastly, the samples cooled to 4˚C for 5 min. Then, cDNAs were amplified with SYBR Green master mix (Roche Molecular Biochemicals, Mannheim Germany) containing 0.5 mM of customizing primers (<xref ref-type="table" rid="table1">Table 1</xref>) for TNF-α, IL-6, PPARγ, PPARα, GLUT-1, ACSL-1, FATP-1, GLUT-4, AdipoQ and, as internal controls, 36B4 and GADPDH, each one plus Fast Star Enzyme, PCR buffer and 3.5 mM MgCl<sub>2</sub> in a final volume of 10 μL. The reactions were measured in a rotor gene system. PCR was conducted using the following cycling conditions: enzyme pre-incubation during 10 min at 95˚C, 35 or 40 cycles denaturizing at 95˚C for 10 sec, a thermal ramp rate of 20˚C per sec; annealing at 61˚C for 7 sec with a thermal ramp rate of 20˚C per sec; amplification at 72˚C for 10 sec with a thermal ramp rate at 20˚C per sec. The threshold cycles (Ct) were measured in separate tubes and duplicates. The identity and purity of the amplified products were checked by electrophoresis on 2% agarose mini gels. Analysis of the melting curve carried out at the end of amplification under the following conditions: denaturation at 95˚C, with a thermal ramp rate of 20˚C per sec, re-annealing at 65˚C for 15 sec, with a thermal ramp rate of 20˚C per sec, and finally slowly denaturizing at 95˚C with a thermal ramp rate of 0.1˚C per sec. Each assay included a negative control for each gene to guarantee the quantity of the measurements. The abundance of mRNA encoding 36B4 normalized the abundance of cytokines mRNA. The ΔCt values were calculated in every sample for each gene of interest as follows: Ct interest—Ct reference with 36B4 or GADPDH as the reference gene (mRNA of reference remained stable throughout the experiments). Relative changes in the expression level of each gene (ΔΔCt) were calculated as ΔCt sample minus ΔCt reference and then presented as 2 − ΔΔCt [<xref ref-type="bibr" rid="scirp.126446-ref18">18</xref>] .</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Genes and primers used in STZ-induced diabetes mice, HepG2 and 3T3-L1</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Genes liver mice</th><th align="center" valign="middle" >Primer forward</th><th align="center" valign="middle" >Primer reverse</th><th align="center" valign="middle" >Pb</th></tr></thead><tr><td align="center" valign="middle" >36B4 Gene bank NM_007475.2</td><td align="center" valign="middle" >AAGCGCGTCCTGGCATTGTCT</td><td align="center" valign="middle" >CCGCAGGGGCAGCAGTGGT</td><td align="center" valign="middle" >135</td></tr><tr><td align="center" valign="middle" >IL-6 Gene bank NM_031168.1</td><td align="center" valign="middle" >TTCCATCCAGTTGCCTTCTT</td><td align="center" valign="middle" >CAGAATTGCCATTGCACAAC</td><td align="center" valign="middle" >129</td></tr><tr><td align="center" valign="middle" >PPAR-γ Gene bank NM_011146.1</td><td align="center" valign="middle" >CCAGAGTCTGCTGATCTGCG</td><td align="center" valign="middle" >GCCACCTCTTTGCTCTGCTC</td><td align="center" valign="middle" >217</td></tr><tr><td align="center" valign="middle" >PPARα Gene bank NM_011144</td><td align="center" valign="middle" >ATGCCAGTACTGCCGTTTTC</td><td align="center" valign="middle" >GGCCTTGACCTTGTTCATGT</td><td align="center" valign="middle" >220</td></tr><tr><td align="center" valign="middle" >TNFα Gene bank NM_013693.2</td><td align="center" valign="middle" >ACTTGGTGGTTTGCTACGAC</td><td align="center" valign="middle" >CCTCCCTGTCATCAGTTCTA</td><td align="center" valign="middle" >102</td></tr><tr><td align="center" valign="middle" >Genes HepG2</td><td align="center" valign="middle" >Primer forward</td><td align="center" valign="middle" >Primer reverse</td><td align="center" valign="middle" >Pb</td></tr><tr><td align="center" valign="middle" >GADPH Gene Bank AF261085.1</td><td align="center" valign="middle" >GAGTCAACGGATTTGGTCGT</td><td align="center" valign="middle" >TTGATTTTGGAGGGATCTCG</td><td align="center" valign="middle" >238</td></tr><tr><td align="center" valign="middle" >PPAR-α Gene BankNM_001001928.2</td><td align="center" valign="middle" >GTTTGAGGGGGTAACAGCAA</td><td align="center" valign="middle" >GCTAACTGCAGAGGGTGAGG</td><td align="center" valign="middle" >247</td></tr><tr><td align="center" valign="middle" >PPAR-γ Gene Bank NM_138712.3</td><td align="center" valign="middle" >GCTGTGCAGGAGATCACAGA</td><td align="center" valign="middle" >GGGCTCCATAAAGTCACCAA</td><td align="center" valign="middle" >225</td></tr><tr><td align="center" valign="middle" >GLUT-1 Gene Bank NM_006516.2</td><td align="center" valign="middle" >TCACTGTGCTCCTGGTTCTG</td><td align="center" valign="middle" >CCTGTGCTCCTGAGAGATCC</td><td align="center" valign="middle" >233</td></tr><tr><td align="center" valign="middle" >ACSL-1 Gene Bank NM_001995.2</td><td align="center" valign="middle" >CCAGAAGGGCTTCAAGACTG</td><td align="center" valign="middle" >GCCTTCTCTGGCTTGTCAAC</td><td align="center" valign="middle" >204</td></tr><tr><td align="center" valign="middle" >FATP-1 Gene Bank NM_198580.1</td><td align="center" valign="middle" >CCACTTGGATGTCACCACTG</td><td align="center" valign="middle" >GTGGGACCCTCCAGTAGACA</td><td align="center" valign="middle" >178</td></tr><tr><td align="center" valign="middle" >Genes 3T3-L1</td><td align="center" valign="middle" >Primer forward</td><td align="center" valign="middle" >Primer reverse</td><td align="center" valign="middle" >Pb</td></tr><tr><td align="center" valign="middle" >36B4 Gene Bank NM_007475.2</td><td align="center" valign="middle" >AAGCGCGTCCTGGCATTGTCT</td><td align="center" valign="middle" >CCGCAGGGGCAGCAGTGGT</td><td align="center" valign="middle" >135</td></tr><tr><td align="center" valign="middle" >PPAR-Δ Gene Bank NM_011145</td><td align="center" valign="middle" >TGGAGCTCGATGACAGTGAC</td><td align="center" valign="middle" >GTACTGGCTGTCAGGGTGGT</td><td align="center" valign="middle" >161</td></tr><tr><td align="center" valign="middle" >PPAR-γ Gene Bank NM_011146.1</td><td align="center" valign="middle" >CCAGAGTCTGCTGATCTGCG</td><td align="center" valign="middle" >GCCACCTCTTTGCTCTGCTC</td><td align="center" valign="middle" >217</td></tr><tr><td align="center" valign="middle" >GLUT-4 Gene Bank NM_009204.2</td><td align="center" valign="middle" >GATTCTGCTGCCCTTCTGTC</td><td align="center" valign="middle" >ATTGGACGCTCTCTCTCCAA</td><td align="center" valign="middle" >168</td></tr><tr><td align="center" valign="middle" >FATP-1 Gene Bank NM_011977.3</td><td align="center" valign="middle" >ACCAGTGTCCAGGGGTACAG</td><td align="center" valign="middle" >TGTCTCCCAGCTGACATGAG</td><td align="center" valign="middle" >174</td></tr><tr><td align="center" valign="middle" >Adipo Q Gene Bank NM_009605.4</td><td align="center" valign="middle" >GGCTCTGTGCTCCTCCATCT</td><td align="center" valign="middle" >AGAGTCGTTGACGTTATCTGCATAG</td><td align="center" valign="middle" >101</td></tr></tbody></table></table-wrap></sec><sec id="s2_9"><title>2.9. Statistical Analysis</title><p>Data are presented as the mean &#177; SEM. Statistical differences among the treatments were determined by an analysis of variance using the Tukey-Kramer Multiple Comparisons post-hoc tests (P &lt; 0.05). All statistics were computed using the NCSS 2000 software.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Effect of the Aqueous Extract from Fruit of C. ficifolia on Glycemia, Body Weight, and Triglycerides in Normal Mice</title><p>Aqueous extract from C. ficifolia fruit administered during the first 15 days did not modify the glycemia of normal mice with free access to food nor prevented the initial STZ-induced hyperglycemia (data not shown). When given during the 30 days post STZ administration, the glycemia was found significatively diminished compared with diabetic control, exhibiting an effect like pioglitazone (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). Body weight was decreased in diabetic mice without treatment (P &lt; 0.05). C. ficifolia extract and none of the other treatments caused significant changes in body weight compared with diabetic control (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). C. ficifolia extract and fenofibrate caused a significant decrease in triglycerides. Pioglitazone did not alter this parameter in STZ-induced diabetic mice (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)).</p></sec><sec id="s3_2"><title>3.2. Effect of the Aqueous Extract from Fruit of C. ficifolia on PPARα and PPARγ Gene Expression in Liver of STZ-Induced Diabetic Mice</title><p>PPARγ and PPARα gene expressions in diabetic mice were always lower than in normal mice (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a) and <xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). C. ficifolia extract did not affect PPARγ but significantly increased PPARα compared to diabetic control. Pioglitazone significantly increased the expression of PPARγ (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)), whereas fenofibrate significantly increase the expression of PPARα (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)).</p></sec><sec id="s3_3"><title>3.3. Effect of the Aqueous Extract from Fruit of C. ficifolia on Expression and Serum Levels of IL-6 and TNF-α in STZ-Induced Diabetic Mice</title><p>The mRNA expression of IL-6 and TNF-α in the liver of STZ-induced diabetic mice was more prominent than in control normal mice. In serum, IL-6 and TNF-α were higher in diabetic mice than in control normal mice; however, just for TNF-α, the difference was statistically significant. C. ficifolia extract caused significant reduction in mRNA expression of both cytokines; however, only for TNF-α, the difference was significant (Figures 3(a)-(c)). C. ficifolia extract did not produce significant changes in serum levels of these cytokines (Figures 3(b)-(d). The treatment with pioglitazone significantly reduced TNF-α expression without significant changes in IL-6 expression or serum levels of IL-6 and TNF-α.</p></sec><sec id="s3_4"><title>3.4. Effect of the Aqueous Extract from Fruit of C. ficifolia on PPARα, PPARγ in ACSL-1, GLUT-1, and FATP-1 in HepG2 Cells</title><p>Cellular viability was assessed in the HepG2 cell line with different doses. For evaluations, a safe concentration was established at 0.078 mM of DCI/g of extract from C. ficifolia fruit extract. C. ficifolia extract significantly increased</p><p>PPARα, PPARγ, and GLUT-1 expression in HepG2 cells (Figures 4(a)-(c)). In contrast, it exhibited a non-significant reduction of FATP-1 and ACSL-1 against control (Figures 4(d) and <xref ref-type="fig" rid="fig4">Figure 4</xref>(e)). Fenofibrate significantly increased PPARα and FATP-1 (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a) and <xref ref-type="fig" rid="fig4">Figure 4</xref>(d)). Fenofibrate also exhibited a non-significant increase of ACSL-1 (<xref ref-type="fig" rid="fig4">Figure 4</xref>(e)). Pioglitazone significantly increased PPARγ and GLUT-1 against control in HepG2 cells (<xref ref-type="fig" rid="fig4">Figure 4</xref>(b) and <xref ref-type="fig" rid="fig4">Figure 4</xref>(c)).</p></sec><sec id="s3_5"><title>3.5. Effect of the Aqueous Extract from Fruit of C. ficifolia on PPARα, PPARγ, GLUT-4, FATP-1, and AdipoQ in 3T3-L1 Cells</title><p>In 3T3-L1 cells, C. ficifolia extract exhibited a non-significant increase of PPARα, PPARγ and AdipoQ (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(b) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(e)) and significantly increased GLUT-4 and FATP-1 against control (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(d)). Pioglitazone exhibited a significant increase of PPARγ, GLUT-4, and AdipoQ against control (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(c) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(e)). Fenofibrate exhibited a significant increase of PPARα and FATP-1 against control (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(d)).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Diabetic and obese patients have alterations in energy balance, accumulating the energy consumed as fat and, consequently, present insulin resistance, hyperglycemia, dyslipidemia, oxidative stress, and chronic inflammation. These anomalies can be associated with deregulating the peroxisome proliferator-activated receptors (PPARs), which play an essential role in the energetic balance that depends on the energy uptake and consumption [<xref ref-type="bibr" rid="scirp.126446-ref19">19</xref>] . Since the aqueous extract from fruit of C. ficifolia has hypoglycemic, hypolipidemic, and anti-inflammatory actions, it was considered essential to study the regulatory capacity of this extract on PPARs in an in vivo model of STZ-induced diabetic mice and in two in vitro models using HepG2 hepatocytes and 3T3-L1adipocytes.</p><p>In STZ-induced diabetic mice, the daily administration of C. ficifolia extract and pioglitazone for 30 days significantly reduced 2-fold glycemia and 1-fold triglyceridemia, without changes in body weight. The hypoglycaemic activity of C. ficifolia extract was reported previously in experimental models and humans [<xref ref-type="bibr" rid="scirp.126446-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref10">10</xref>] and our results are congruent with the previous data.</p><p>Loss of body weight is considered a typical condition in diabetic patients, which is associated with hyperglycemia and hypertriglyceridemia. Control diabetic mice showed weight loss; however, any treatment from the present study modified this parameter. In addition to reducing glucose, C. ficifolia extract also significantly decreased triglyceride levels in diabetic mice, as reported previously by [<xref ref-type="bibr" rid="scirp.126446-ref6">6</xref>] also in STZ-induced diabetes mice. In contrast, pioglitazone lowered blood glucose but did not exhibit an effect on triglycerides. Pioglitazone is a thiazolidinedione (TZD) with PPARγ agonist action that improve insulin sensitivity. This action occurs by regulating gene expression of several proteins involved in the lipogenesis of adipocyte tissue [<xref ref-type="bibr" rid="scirp.126446-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref21">21</xref>] , causing fatty liver and hepatic steatosis, a condition considered one of the principal undesirable effects of TZDs.</p><p>PPARs are transcription factors composed of three isoforms, PPARα, PPARβ/Δ, and PPARγ. These factors regulate energetic balance by expressing several proteins involved in lipogenesis and lipolysis [<xref ref-type="bibr" rid="scirp.126446-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref22">22</xref>] . C. ficifolia extract did not change PPARγ gene expression in the liver of STZ-induced diabetic mice, compared with diabetic control. Instead, it showed a significant reduction of 20% in TNF-α expression, an important inflammatory modulator. Besides, C. ficifolia extract significantly increased 2-fold PPARα, which is involved in the uptake, activation, and oxidation of fatty acids [<xref ref-type="bibr" rid="scirp.126446-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref22">22</xref>] . These data in diabetic mice suggest that C. ficifolia extract propitiates a new energetic balance decreasing glucose and triglycerides and improving inflammatory conditions associated with decreased TNF-α expression. Pioglitazone increased PPARγ, PPARα, and TNF-α gene expression and reduced glycemia without modifying triglycerides. Since C. ficifolia extract showed the hypotriglyceridemic effect, this may represent an advantage against TZD agents, avoiding liver fat accumulation. However, the mechanisms implicated in these effects of C. ficifolia extract should be explored in further studies.</p><p>Results in STZ-diabetic mice also suggest that C. ficifolia extract can act like a PPARα agonist, modulating the glucose/lipids balance. [<xref ref-type="bibr" rid="scirp.126446-ref15">15</xref>] demonstrated that ob/ob mice and Zucker rats, subjected to PPAR-α agonist treatment, decreased body fat, glycemia, and insulin levels, promoting sensitive insulin ( [<xref ref-type="bibr" rid="scirp.126446-ref23">23</xref>] . PPARα is stimulated by fibrates such as gemfibrozil, clofibrate, fenofibrate, and ciprofibrate, decreasing triglycerides and increasing high-density lipoproteins (HDL). In addition, PPARα promotes lipolysis and decreases very low-density lipoproteins (VLDL) [<xref ref-type="bibr" rid="scirp.126446-ref19">19</xref>] . Although some biomarkers of metabolism of carbohydrates in liver were measured in previous studies [<xref ref-type="bibr" rid="scirp.126446-ref5">5</xref>] , other biomarkers of metabolism of carbohydrates and lipids must be further studied.</p><p>PPARα in the liver modulates gene expression of enzymes that participate in the mitochondrial and peroxisomal fat acids oxidation and ketogenesis, like 3-hidroxy-3-methiylglutaril-CoA synthetase 2 (HMGCS2), carnitine palmitoyl transferase A (CPT1A), carnitine palmitoyl transferase 2 (CPT2), enoyl CoA synthetase 1 peroxisomal (ECH1), as well as for the expression of genes that participate in the binding and activation of fat acids, like the liver fat acids binding protein 1(FABP1), and the isoforms 1 and 3 of long-chain-fatty-acid-CoA ligase (ACSL-1, ACSL-3) [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . In HepG2 cells, C. ficifolia significantly increased PAPRα (1-fold), PPARγ (0.5-fold), and GLUT-1 (2-fold) gene expression and caused a non-significant decrease in ACSL-1 and FATP-1. Concerning PPARα, this result in HepG2 cells is congruent with the found in the liver of STZ-induced diabetic mice. Hence the importance of PPARα regulation in lipid metabolism.</p><p>The ACSLs catalyze the first pass in lipid metabolism, modifying long-chain fatty acids in acyl CoA thioesters. Five isoforms in mammals have been described [<xref ref-type="bibr" rid="scirp.126446-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref25">25</xref>] . The acetyl-CoA groups participate in anabolic and catabolic routes, participating in triglycerides synthesis and oxidation processes. The isoform ACSL-1 is highly expressed in the liver and adipose tissue. Therefore, expression of RNAm of Acsl-1 in these tissues is potentiated by the activation of PPARα, participating in the β-oxidation of fatty acids [<xref ref-type="bibr" rid="scirp.126446-ref26">26</xref>] .</p><p>Fenofibrate, a PPARα agonist, promoted mRNA expression of PPARα and ACSL-1. In HepG2 cells, C. ficifolia increased PPARα expression without significantly modifying ACSL. These results are congruent with previous studies in liver ACSL-1 knock-out mice, in which was observed decrease of 50% in the total activity of the ACSLs and reductions of 25% to 35% in the content of long chain acetyl-CoA [<xref ref-type="bibr" rid="scirp.126446-ref24">24</xref>] . Besides, anabolic and catabolic routes may be altered in pathologies such as liver steatosis, hyperlipidemia, and insulin resistance [<xref ref-type="bibr" rid="scirp.126446-ref24">24</xref>] . The data also suggest that C. ficifolia extract may transcriptionally stimulate PPARα expression in vivo and in vitro without activating the pathways associated with ACSL-1 and FATP-1 in Hep-G2 cells submitted at 24 h de incubation. Whatever it is, further studies will be mandatory to perform studies to know the temporal curse variations in the expression and protein levels of these parameters, particularly of ACSL-1, in the liver after treatment with C. ficifolia extract.</p><p>Although the PPARα role in the metabolism of carbohydrates and lipids is well recognized in the liver, the PPARγ role in this organ, where this factor is expressed at low levels, is less known. C. ficifolia extract did not increase liver PPARγ expression in STZ-induced diabetic mice, but in HepG2 cells, this factor of transcription was increased significantly in 50%. PPARγ has been a focus of attention as a transcription factor associated with metabolic syndrome in adipocytes [<xref ref-type="bibr" rid="scirp.126446-ref27">27</xref>] . However, its overexpression in hepatocytes has been associated with hepatosteatosis, regulating several proteins associated with lipid uptake, triglyceride storage, and formation of lipid droplets, such as FABP4, fat-specific protein 27 (FSP27)/Cidec, CD36, monoacylglycerol O-acyltransferase 1, and perilipin 2 ( [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . PPARγ is one of the typical phenotypes of steatotic animals associated with obesity and without obesity, which lack triglyceride-storing capacity in adipocytes [<xref ref-type="bibr" rid="scirp.126446-ref28">28</xref>] After pancreaticoduodenectomy, similar overexpression of hepatic PPARγ was observed in generally non-obese NAFLD/NASH patients [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref28">28</xref>] .</p><p>Since activation of PPARγ is steatogenic, the C. ficifolia extract null effect on PPARγ in diabetic mice may be considered beneficial. However, treating genetically obese or diet induced NAFLD/NASH mice with PPARγ ligands also can decrease hepatic triglycerides. This distinct effect may be attributed to an enhanced adiponectin synthesis in adipose tissue [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . Circulating adiponectin could increase glucose uptake and lipid oxidation in hepatocytes by activating AMPK, thereby improving systemic insulin sensitivity, and reducing liver steatosis [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] . However, C. ficifolia extract did not significantly affect adiponectin in 3T3-L1 adipocytes.</p><p>PPARγ activation reduces inflammatory response by negatively interfering with NF-κB and signal transducers and transcriptional activators [<xref ref-type="bibr" rid="scirp.126446-ref14">14</xref>] , suppressing the production of pro-inflammatory cytokines in 20%, including TNF-α. PPARγ also has significant anti-inflammatory properties, which can regulate the inflammatory immune response. C. ficifolia extract reduced pro-inflammatory cytokines TNF-α and IL-6 expression in 20% at 25% in STZ-induced diabetic mice.</p><p>The glut-1 promotor in HepG2 cells has regions of response to the transcription complex HIF-1α/ARNT [<xref ref-type="bibr" rid="scirp.126446-ref29">29</xref>] . In the case of GLUT-1, this transporter might be participating in the C. ficifolia extract hypoglycemic effect, promoting glucose intake in hepatocytes and probably in other tissues that also express this transporter, like brain, muscle, pancreas, and adipose tissue, contributing to glycemic control in the organism [<xref ref-type="bibr" rid="scirp.126446-ref30">30</xref>] This effect on GLUT-1 expression due to C. ficifolia extract may be associated with an enhancement in HIF-1α/ARNT pathway, better than with PPARs. Therefore, this cellular line may not be suitable for studying PPARα activation, given its carcinogenic origin and hypoxia characteristics. Further studies will be necessary using primary cultures of hepatocytes for to clarify the participation of these pathways in the effects of C. ficifolia extract in liver, as well as study the participation of other glucose transporters, as GLUT-2, in the effects of C. ficifolia extract.</p><p>In 3T3-L1 adipocytes, PPARγ expression was not significantly affected. Adipogenesis in 3T3-L1 cells is preceded by an increase in C/EBP-β and CEBP-Δ expression, whose posterior reduction is associated with an increase in C/EBP-α and PPARγ. PPARγ expression in adipocytes by C. ficifolia extract did not change, probably due to the process of adipogenesis at eight days, beginning with PPARγ constant expression levels that promote the adipogenesis and expression of genes, like GLUT-4.</p><p>C. ficifolia extract significantly promoted FATP-1 expression, probably associated with the non-significant increase in PPARγ observed in 3T3-L1 adipocytes. All data suggest that C. ficifolia extract promotes the activation of PPARs in adipocytes; the increase in FATP-1 (2-fold) and GLUT-4 (1.5-fold) expression in these cells by C. ficifolia extract may explain part of the hypoglycemic effect, enhancing glucose and fatty acids, as well as its storage as triglycerides, as it has been observed.</p><p>D-chiro-inositol is a glycan, a second messenger in the classic insulin route. Its administration improves glucose tolerance, insulin resistance, and type 2 diabetes [<xref ref-type="bibr" rid="scirp.126446-ref31">31</xref>] . The extract of C ficifolia contained 3.32 mg/g of extract, and this quantity was used as a reference to calculate the concentrations used in all the treatments with C. ficifolia extract. Given the polar nature of D-chiro inositol, in contrast with the lipophilic nature of the ligands of PPARs, it is possible that other compounds, apart from D-chiro-inositol, also are participating in these effects of C. ficifolia extract, like β-sitosterol and 4-hydroxybenzoic acid that were isolated from C. ficifolia, exhibiting insulin secretagogue action in RINm5F and activation of PPARγ in C2C12 myocytes [<xref ref-type="bibr" rid="scirp.126446-ref11">11</xref>] , increasing expression of GLUT-4, which may be contributing to the hypoglycemic action of C. ficifolia extract. This effect on GLUT-4 also was observed in 3T3-L1 adipocytes by C. ficifolia extract.</p><p>Also, some terpenoids have been suggested as dual agonists of PPAR-α/ PPAR-γ, particularly isoprenyl-like farnesol, and geranylgeraniol, with dual activity in HepG2 and 3T3-L1 [<xref ref-type="bibr" rid="scirp.126446-ref32">32</xref>] . In this context, cucurbitacins of C. ficifolia, triterpenes characterized by the presence of a cucurbitacin nucleus (19-(10 → 9β)-abeo-10α-lanostano-5-ene), described in the Cucurbitaceae family, might be participating in these actions [<xref ref-type="bibr" rid="scirp.126446-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.126446-ref34">34</xref>] . However, the presence of these compounds and their participation in these actions should be studied in posterior studies.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, the aqueous extract from fruit of C. ficifolia contains PPAR agonists that modify the glucose metabolism of carbohydrates and lipids, implicating diverse cell types associated with its metabolism, such as hepatocytes, adipocytes, and skeletal muscle cells, with a capacity to stabling altered processes in pathologies associated with chronic inflammatory response characteristic of obesity, type 2 diabetes, and other metabolic diseases.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This research was supported by CONACyT; FORDECYT-PRONACES (Ciencia de Frontera 377882/2020). The present study was supported by a grant from CONACyT to VHR as part of his Master in Experimental Biology in the DCBS at Universidad Aut&#243;noma Metropolitana-Iztapalapa. We would like to thank to the UMADI of the DCBS at UAM-I for the technical assistance.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflict of interest.</p></sec><sec id="s8"><title>Cite this paper</title><p>Almanza-Perez, J.C., Hernandez-Rosado, V., Fortis-Barrera, A., Blancas-Flores, G., Alarcon-Villase&#241;or, E., Flores-Saenz, J.L., Rosiles-Alanis, W. and Alarcon-Aguilar, F.J. (2023) Cucurbita ficifolia Bouch&#233; Regulates the Metabolism of Carbohydrates and Lipids in Liver by Activation of PPARα without Affectation on PPARγ in Vivo and in Vitro. American Journal of Plant Sciences, 14, 763-781. https://doi.org/10.4236/ajps.2023.147051</p></sec></body><back><ref-list><title>References</title><ref id="scirp.126446-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Acosta-Patino, J.L., Jimenez-Balderas, E., Juarez-Oropeza, M.A. and Diaz-Zagoya, J.C. (2001) Hypoglycemic Action of Cucurbita ficifolia on Type 2 Diabetic Patients with Moderately High Blood Glucose Levels. Journal of Ethnopharmacology, 77, 99-101. https://doi.org/10.1016/S0378-8741(01)00272-0</mixed-citation></ref><ref id="scirp.126446-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Alarcon-Aguilar, F.J., Hernandez-Galicia, E., Campos-Sepulveda, A.E., Xolalpa-Molina, S., Rivas-Vilchis, J.F., Vazquez-Carrillo, L.I. and Roman-Ramos, R. (2002) Evaluation of the Hypoglycemic Effect of Cucurbita ficifolia Bouche (Cucurbitaceae) in Different Experimental Models. Journal of Ethnopharmacology, 82, 185-189.  
https://doi.org/10.1016/S0378-8741(02)00176-9</mixed-citation></ref><ref id="scirp.126446-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Banderas, D.T.R., Roman, R.R., Zamilpa, A., Garcia, M.R., Diaz, M., Campos, M.G., Tortoriello, J. and Alarcon, A.F.J. (2012) Influence of Two Hypoglycemic Cucurbitaceae (Cucurbita ficifolia Bouché and Ibervillea sonorae Greene) on ATP-Sensitive Potassium Channels in Rat Aortic Rings. Boletín Latinoamericano y del Caribe de Plantas Medicinales y Aromáticas, 11, 510-519.</mixed-citation></ref><ref id="scirp.126446-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Miranda-Perez, M.E., Ortega-Camarillo, C., Escobar-Villanueva, M.C., Blancas-Flores, G. and Alarcon-Aguilar, F.J. (2016) Cucurbita ficifolia Bouche Increases Insulin Secretion in RINm5F Cells through an Influx of Ca2+ from the Endoplasmic Reticulum. Journal of Ethnopharmacology, 188, 159-166.  
https://doi.org/10.1016/j.jep.2016.04.061</mixed-citation></ref><ref id="scirp.126446-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Garcia-Gonzalez, J., Garcia Lorenzana M., Zamilpa A., Almanza Perez, J.C., Jasso Villagomez, E.I., Roman Ramos, R. and Alarcon-Aguilar, F.J. (2017) Chemical Characterization of a Hypoglycemic Extract from Cucurbita ficifolia Bouche That Induces Liver Glycogen Accumulation in Diabetic Mice. African Journal of Traditional and Complementary and Alternative Medicine, 14, 218-230.  
http://journals.sfu.ca/africanem/index.php/ajtcam/article/view/4677 
https://doi.org/10.21010/ajtcam.v14i3.24</mixed-citation></ref><ref id="scirp.126446-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Roman Ramos, R., Almanza Pérez, J.C., Fortis Barrera, A., Angeles Mejia, S., Banderas Dorantes, T.R., Zamilpa Alvarez, A., Diaz Flores, M., Jasso, I., Blancas Flores, G., Gomez, J. and Alarcon Aguilar, F.J. (2012) Antioxidant and Anti-Inflammatory Effects of Hypoglycemic Fraction from Cucurbita ficifolia Bouche in Streptozotocin-Induced Diabetes Mice. American Journal of Chinese Medicine, 40, 97-110.  
https://doi.org/10.1142/S0192415X12500085</mixed-citation></ref><ref id="scirp.126446-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Díaz, F.M., Angeles, M.S., Baiza, G.L.A., Medina, N.R., Hernandez, S.D., Ortega, C.C., Roman, R.R., Cruz, M. and Alarcon, A.F.J. (2012) Effect of an Aqueous Extract of Cucurbita ficifolia Bouché on the Glutathione Redox Cycle in Mice with STZ-Induced Diabetes. Journal of Ethnopharmacology, 144, 101-108.  
https://doi.org/10.1016/j.jep.2012.08.036</mixed-citation></ref><ref id="scirp.126446-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Fortis, B.M.A., Alarcón, A.F.J., Banderas D.T., Díaz, F.M, Román, R.R., Cruz, M. and García, M.R. (2013) Cucurbita ficifolia Bouché (Cucurbitaceae) and D-chiro-Inositol Modulate the Redox State and Inflammation in 3T3-L1 Adipocytes. Journal of Pharmacy and Pharmacology, 65, 1563-1576.  
https://doi.org/10.1111/jphp.12119</mixed-citation></ref><ref id="scirp.126446-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Fortis, B.M.A., García-M.R., Almanza, P.J.C., Blancas, F.G., Zamilpa, A.A., Flores, S.J.L., Cruz, M., Román, R.R. and Alarcón, A.F.J. (2017) Cucurbita ficifolia Bouché (Cucurbitaceae) Modulates Inflammatory Cytokines and IFN-γ in Obese Mice. Canadian Journal of Physiology and Pharmacology, 95, 170-177.  
https://doi.org/10.1139/cjpp-2015-0475</mixed-citation></ref><ref id="scirp.126446-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Xia, T. and Wang, Q. (2006) D-chiro-inositol Found in Cucurbita ficifolia (Cucurbitaceae) Fruit Plays a Hypoglycaemic Role in Streptozocin-Diabetic Rats. Journal of Pharmacy and Pharmacology, 58, 1527-1532.  
https://doi.org/10.1211/jpp.58.10.0014</mixed-citation></ref><ref id="scirp.126446-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Rosiles, A.W., Zamilpa, A., García, M.R., Zavala, S.M.A., Hidalgo, F.S., Mora Ramiro, B., Román, R.R., Estrada Soto, S.E. and Almanza, P.J.C. (2022) 4-Hydroxybenzoic Acid and Beta-Sitosterol from Cucurbita ficifolia Act as Insulin Secretagogues, Peroxisome Proliferator-Activated Receptor-Gamma Agonists, and Liver Glycogen Storage Promoters: In Vivo, in Vitro, and in Silico Studies. Journal of Medicinal Food, 25, 588-596. https://doi.org/10.1089/jmf.2021.0071</mixed-citation></ref><ref id="scirp.126446-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Kersten, S., Desvergne, B. and Wahli, W. (2000) Roles of PPAR in Health and Disease. Nature, 405, 421-424. https://doi.org/10.1038/35013000</mixed-citation></ref><ref id="scirp.126446-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Evans, R.M., Barish, G.D. and Wang, Y.X. (2004) PPARs and the Complex Journey to Obesity. Natural Medicine, 10, 355-361. https://doi.org/10.1038/nm1025</mixed-citation></ref><ref id="scirp.126446-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Y., Nakajima, T., Gonzalez, F.J. and Tanaka, N. (2020) PPARs as Metabolic Regulators in the Liver. Lessons from Liver-Specific PPAR-Null Mice. International Journal of Molecular Sciences, 21, Article No. 2061.  
https://doi.org/10.3390/ijms21062061</mixed-citation></ref><ref id="scirp.126446-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Guerre-Millo, M. (2004) Adipose Tissue and Adipokines: for Better or Worse. Diabetes Metabolism, 30, 13-19. https://doi.org/10.1016/S1262-3636(07)70084-8</mixed-citation></ref><ref id="scirp.126446-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Fiévet, C., Fruchart, J.C. and Staels, B. (2006) PPARα and PPARγ Dual Agonists for the Treatment of Type 2 Diabetes and the Metabolic Syndrome. COPHAR, 6, 606-614.  
https://doi.org/10.1016/j.coph.2006.06.009</mixed-citation></ref><ref id="scirp.126446-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Fasshauer, M., Klein, J., Lossner, U. and Paschke, R. (2003) Interleukin (IL)-6 mRNA Expression Is Stimulated by Insulin, Isoproterenol, Tumor Necrosis Factor-Alpha, Growth Hormone, and IL-6 in 3T3-L1 Adipocytes. Hormone and Metabolic Research, 35, 147-152. https://doi.org/10.1055/s-2003-39075</mixed-citation></ref><ref id="scirp.126446-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Dehoux, M.J., Van Beneden, R.P., Fernandez-Celemin, L., Lause, P.L. and Thiissen, J.P. (2003) Induction of MafBx and Murf Ubiquitin Ligase mRNAs in Rat Skeletal Muscle Alter LPS Injection. FEBS Letters, 544, 214-217.  
https://doi.org/10.1016/S0014-5793(03)00505-2</mixed-citation></ref><ref id="scirp.126446-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Gross, B. and Staels, B. (2007) PPAR Agonists: Multimodal Drugs for the Treatment of Type-2 Diabetes. Best Practice &amp; Research Clinical Endocrinology &amp; Metabolism, 21, 687-710. https://doi.org/10.1016/j.beem.2007.09.004</mixed-citation></ref><ref id="scirp.126446-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Dunn, F.L., Higgins, L.S., Fredrickson, J. and DePaoli, A.M. (2010) Selective Modulation of PPARγ Activity Can Lower Plasma Glucose without Typical Thiazolidinedione Side Effects in Patients with Type 2 Diabetes. Journal of Diabetes Complications, 25, 151-158. https://doi.org/10.1016/j.jdiacomp.2010.06.006</mixed-citation></ref><ref id="scirp.126446-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Tahrani, A.A., Piya, M.K., Kennedy, A. and Bammet, A.H. (2010) Glycaemic Control in Type 2 Diabetes: Targets and New Therapies. Pharmacology &amp; Therapeutics, 125, 328-361. https://doi.org/10.1016/j.pharmthera.2009.11.001</mixed-citation></ref><ref id="scirp.126446-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Berger, J. and Moller, D.E. (2002) The Mechanisms of Action PPARs. Annual Review of Medicine, 53, 409-435.  
https://doi.org/10.1146/annurev.med.53.082901.104018</mixed-citation></ref><ref id="scirp.126446-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Haluzík, M.M. and Haluzík, M. (2006) PPAR-α and Insulin Sensitivity. Physiological Research, 55, 115-122. https://doi.org/10.33549/physiolres.930744</mixed-citation></ref><ref id="scirp.126446-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Li, L.O., Ellis, J.M., Paich, H.A., Wang, S., Gong, N., Altshuller, G., Thresher, R.J., Koves, T.R., Watkins, S.M., Muoio, D.M., Cline, G.W., Shulman, G.I. and Coleman, R.A. (2009) Liver-Specific Loss of Long Chain acyl-CoA Synthetase-1 Decreases Triacylglycerol Synthesis and β-Oxidation and Alters Phospholipid Fatty Acid Composition. Journal of Biological Chemistry, 284, 27816-27826.  
https://doi.org/10.1074/jbc.M109.022467</mixed-citation></ref><ref id="scirp.126446-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Soupene, E. and Kuypers, F.A. (2008) Mammalian Long-Chain acyl-CoA Synthetases. Experimental Biology Medicine, 233, 507-521.  
https://doi.org/10.3181/0710-MR-287</mixed-citation></ref><ref id="scirp.126446-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Young, P.A., Senkal, C.E., Suchanek, A.L., Grevengoe, T.J., Lin, D.D., Zhao, L., Crunk, A.E., Klett, E.L., Füllerkrug, J., Obeid, L.M. and Coleman, R.A. (2018) Long-Chain acyl-CoA Synthetase 1 Interacts with Key Proteins That Activate and Direct Fatty Acids into Niche Hepatic Pathways. Journal of Biological Chemistry, 293, 16724-16740. https://doi.org/10.1074/jbc.RA118.004049</mixed-citation></ref><ref id="scirp.126446-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Kawai, M. and Rosen, C.J. (2010) PPARγ: A Circadian Transcription Factor in Adipogenesis and Osteogenesis. Nature Review Endocrinology, 6, 629-636.  
https://doi.org/10.1038/nrendo.2010.155</mixed-citation></ref><ref id="scirp.126446-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Geisler, C.E. and Renquist, B.J. (2017) Hepatic Lipid Accumulation: Cause and Consequence of Dysregulated Glucoregulatory Hormones. Journal of Endocrinology, 234, 1-21. https://doi.org/10.1530/JOE-16-0513</mixed-citation></ref><ref id="scirp.126446-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Macheda, M.L., Rogers, S. and Best, J.D. (2005) Molecular and Cellular Regulation of Glucose Transporter (GLUT) Proteins in Cancer. Journal of Cell Physiology, 202, 654-662. https://doi.org/10.1002/jcp.20166</mixed-citation></ref><ref id="scirp.126446-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ge, T.F., Law, P.Y., Wong, H.Y. and Ho, Y.Y. (2007) Gatifloxacin Affects GLUT1 Gene Expression and Disturbs Glucose Homeostasis in Vitro. European Journal of Pharmacology, 573, 70-74. https://doi.org/10.1016/j.ejphar.2007.07.038</mixed-citation></ref><ref id="scirp.126446-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Galazis, N., Galazi, M. and Atiomo, W. (2011) D-Chiro-inositol and Its Significance in Polycystic Ovary Syndrome: A Systematic Review. Gynecological Endocrinology, 27, 256-262. https://doi.org/10.3109/09513590.2010.538099</mixed-citation></ref><ref id="scirp.126446-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Takahashi, N., Kawada, T., Goto, T., Yamamoto, T., Taimatsu, A., Matsui, N., Kimura, K., Saito, M., Hosokawa, M., Miyashita, K. and Fushiki, T. (2002) Dual Action of Isoprenoids from Herbal Medicines on both PPARγ and PPARα in 3T3-L1 Adipocytes and HepG2 Hepatocytes. Federation of European Biochemical Societies Letters, 514, 315-322. https://doi.org/10.1016/S0014-5793(02)02390-6</mixed-citation></ref><ref id="scirp.126446-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Xu, H., Barnes, GT, Yang, Q., Tan G, Yang, D., Chou, Ch.J., Sole, J., Nichols, A., Ross, J.S., Tartaglia, L.A. and Chen, H. (2003) Chronic Inflammation in Fat Plays a Crucial Role in the Development of Obesity-Related Insulin Resistance. Journal of Clinical Investigation, 112, 1821-1830. https://doi.org/10.1172/JCI200319451</mixed-citation></ref><ref id="scirp.126446-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Dhiman, K., Gupta, A., Sharma, D.K., Gill, N.S. and Goyal, A. (2012) A Review on the Medicinally Important Plants of the Family Cucurbitaceae. Asian Journal of Clinical Nutrition, 4, 16-26. https://doi.org/10.3923/ajcn.2012.16.26</mixed-citation></ref></ref-list></back></article>