Promoter Region Analysis of STAMP1/STEAP2 Gene-Silencing of STAMP1/STEAP2 Gene Triggers P53 Upregulation

Prostate cancer is the most commonly diagnosed cancer and the second leading cause of cancer mortality in men in the Western World. In the initial stages, prostate cancer is dependent on androgens for growth which is the basis for androgen ablation therapy. The effects of androgens are mediated by the Androgen Receptor (AR). Therefore, studies focus on the identification of AR - regulated genes that are also highly expressed in the prostate. STAMP family genes STAMP1/STEAP2 and STAMP2/STEAP4 have only expressed in androgen receptor - positive cells, the role of AR in STAMP family gene ex pression is an important question. STEAP (Six Transmembrane Epithelial Antigen of Prostate) is the first characterized prostate of enriched six transmembrane gene, expressed in metastatic prostate cancer samples, it is tempting to speculate that STAMP/STEAP family genes may be involved in similar functions with a role for both the normal biology and pathophysiology of the prostate. Using siRNA technology in LNCaP cells expressing STAMP genes per se, an apoptosis panel including pro-apoptotic and/or apoptotic molecules was assayed by RT-PCR, By this research project, prostate-specific STAMP gene family and its regulatory effects on the p53- and caspase-related pathways were characterized.

• LNCaP
• STAMP1/STEAP2
• P53
• RT-PCR

1. Significance Statement

In silico analysis of the promoter of STAMP1/STEAP2 gene and target gene response element regions were examined using the Genomatix website, and the 1.2 kilobase promoter regions of STAMP1/STEAP2 (see Figure 1).

2. Introduction

Prostate cancer is an important issue in men due to the prolonged life expectancy in modern society. The mechanisms involved in the pathology, which causes morbidity and mortality, have not yet been fully understood. It is a type of cancer that cannot be clarified and therefore cannot be fully treated. In the initial phase of the disease, tumor growth occurs androgen-dependent forms the basis of androgen ablation therapy currently in use [1].

However, in many cases, prostate cancer reverts to an androgen-independent phenotype and there is currently no successful treatment that results in mortality [2]. With the studies carried out in recent years, androgen-regulated and prostate-specific genes have been identified. Prostate-Specific Antigen (PSA)/Kallikrein 3 (KLK3) clinical as a tumor marker, it is routinely used to detect prostate cancer and monitor its development [3]. Many other androgen-regulated genes are also implicated in the prostate. May be listed as KLK2 [4], KLK4 [4] [5], NKX3.1 [6] [7] [8].

It is regulated positively/negatively by PCGEM1 [9] and many more androgens. The gene is identified and characterized by multiple cell-based analysis methods, studies continue [10] [11]. We searched for prostate-specific genes expressed in the early stages of prostate cancer. In one project, we came across a gene with six transmembrane domains at its C-terminus (Six Transmembrane Protein of Prostate 1, STAMP1) [12] [13] and later STAMP2 [14] [15] and STAMP3 were identified.

3. Materials and Methods

Cell culture: LNCaP cells were cultured in RPMI-1640 (Gibco-BRL, Gaithersburg, MD, USA) with 10% Fetal Bovine Serum (FBS), 1% L-glutamine and 1 U/ml each of penicillin/streptomycin. Cells were incubated at 37˚C with 5% CO₂ in a humidified atmosphere. The cell lines were purchased from ATCC (Manassas, VA, USA).

siRNA-mediated knockdown of genes LNCaP cells were transfected with either scrambled control siRNA (sc-37007) or p53-specific siRNA (sc-29435), STAMP1 specific siRNA: (sc-76587) purchased from Santa Cruz Biotechnology Inc. (Dallas, TX, USA). The sequences were provided by the manufacturer.

A total of 100 pmol siRNA (final concentration, 50 nM) was used to transfect cells with the aid of 10 μl FuGENE HD transfection reagent and the cells were incubated with the siRNA construct for 1 and 4 days, respectively, in accordance with the manufacturer’s instructions.

Reverse Transcription quantitative Polymerase Chain Reaction (RT-qPCR) using a panel of apoptosis-related gene primers. qPCR was performed using a Light Cycler^® 480 (Roche Diagnostics) instrument and Light Cycler 480 SYBR Green 1 Master kit (Roche Diagnostics). Briefly, the reactions were performed in a 20-μl volume with 5 pmol of each primer and 1 μl of cDNA template derived from reverse-transcribed RNA of scrambled siRNA (control) and p53-siRNA-transfected cells. The primers used are shown in Table 1. GAPDH, a human housekeeping gene, was used as an endogenous control and reference gene for relative quantifications. The same thermal profile was optimized for all primers: pre-incubation for 5 min at 95˚C for 1 cycle, followed by 40 cycles of denaturation at 95˚C for 10 sec, primer annealing at 64˚C for 20 sec, and primer extension at 72˚C for 10 sec. Water was included as a no-template control. Melting curves were derived after 40 cycles by a denaturation step at 95˚C for 10 sec, followed by annealing at 65˚C for 15 sec, and a temperature rise to 95˚C with a heating rate of 0.1˚C/sec and continuous fluorescence measurement. Final cooling was performed at 37˚C for 30 sec. Melting curve analyses of each sample were performed using LightCycler 480 Software version LCS480 (Roche Diagnostics). The analysis step of relative quantification was a fully automated process accomplished by the software, with the efficiency set at 2 and the cDNA of untreated cells defined as the calibrator.

Statistical analysis: All results represent one of at least three independent experiments with similar outcomes. All data are expressed as the mean ± standard error of mean. One-way analysis of Variance (ANOVA) and Tukey post hoc test were used to compare groups of data. P ≤ 0.05 was considered to indicate a statistically significant result. GraphPad Software, Version 4.03 (San Diego, CA, USA) was used for the statistical analysis (see Table 2).

4. Results

Silencing of the apoptotic gene p53-siRNA administration:

LNCaP cells have the mutant p53 gene, although standard p53 siRNA has been developed by Santa Cruz Biotechnology Inc. (Bergheimer, Germany). In amplifications using primers specific for p53 1, 2, and 4 siRNA samples versus the control, day 4 was considered the day with optimal silencing for apoptosis panel RT-PCR –amplification (see Figure 2 and Figure 3).

With suppression of STAMP1, 2.8 fold in BCL2L1 compared to control, at a relative expression of 3.67-fold in p53, 2.86-fold in caspase 7 and 3.48-fold in caspase 9 expression increased and decreased in MDM2, AKT1 were shown (see Figure 4).

Table 1

Genes and primers used as an apoptosis panel for quantitative Polymerase Chain Reaction (qPCR) analysis

GENE BANK	SYMBOL	DEFİNİTİON	GENE NAME	LEFT PRİMER	RİGHT PRİMER
NM_0043 22	BAD	BCL2-antagonist of cell death	BBC2/BCL2L8	AGGATCCGTGCTGTCTCCTTTG	CAAAACTTCCGATGG GACCAAG
NM_0011 88	BAK1	BCL2-antagonist/killer 1	BAK/BCL2L7	GGGTGTAGATGGGGGAACTGTG	AAGACCCTAGGCTGT GCCCAAT
NM_1385 78	BCL2L	BCL2-like 1	BCL-X/BCL-XL	GTGTGAGGAGCTGCTGGCTTG	AGCATCAGGCCGTCC AATCTC
	1
NM_0012 5	BNIP1	BCL2/adenovirus E1B 19kDa interacting protein 1	NIP1/TRG-8	CAGGTTGGATGGAACACAGTGC	ATCCCAATGCCAGAC CTTCCTC
NM_0329 82	CASP2	Caspase 2, apoptosis-related cysteine protease	CASP-2/ICH-1L	TCTCCCATGGTCCCTAGCAAAA	AAGGCTCACAAACCA CCCAAAC
NM_0012 27	CASP7	Caspase 7, apoptosis-related cysteine protease	CMH-1/ICE-LAP3	AAGTGAGGAAGAGTTTATGGCAA A	CCATCTTGAAAACAA AGTGCCAAA
NM_0012 29	CASP9	Caspase 9, apoptosis-related cysteine protease	APAF-3/APAF3	TCCTGAGTGGTGCCAAACAAAA	AGTGGTTGTCAGGC GAGGAAAG
NM_0051 57	ABL1	V-abl Abelson murine leukemia viral oncogene homolog 1	ABL/C-ABL	GGCCTTGAAGACAGAGCAAAGC	GGAAGGGACCAGTA CCTCATGG
NM_0051 63	AKT1	V-akt murine thymoma viral oncogene homolog 1	PKB/PRKBA	TCCCCCTCAGATGATCTCTCCA	CGGAAAGGTTAAGC GTCGAAAA
NM_0054	TP73	Tumor protein p73	P73	AGCAGCCCATCAAGGAGGAGTT	TCCTGAGGCAGTTTT GGACACA
NM_0005 46	TP53	Tumor protein p53 (Li-Fraumeni syndrome)	CYS51STOP/P53	AGATGGGGTCTCACAGTGTTGC	ATGTTGACCCTTCCA GCTCCAC
NM_0784 67	P21	Homosapiens cyclin-dependent kinase inhibitor 1A	CDKN1A	GGCAGACCAGCATGACAGATT	GCGGCCAGGGTATG TACATGA
NM_0023 92	MDM2	Homo sapiens Mdm2, transformed 3T3 cell double minute 2	HDMX/MGC71221	GGGTTCGCACCATTCTCCTG	GGCAGATGACTGTA GGCCAAGC
NM_0163 35	PRODH	Homo sapiens proline dehydrogenase (oxidase) 1	PIG6/HSPOX2	TTTTTCACCCCACACTTGCAGA	TGTCCCAGGCAGGT ATCAGGTT
NM_0011 01	ACTB	Homo sapiens actin, beta	PS1TP5BP1, beta-actin	CAATGTGGCCGAGGACTTTGAT	AGTGGGGTGGCTTTT AGGATGG
NM_0020 46	GAPDH	Homo sapiens glyceraldehide 3-phosphate dehydrogenase	G3PD, GAPD	CATTGCCCTCAACGACCACTTT	GGTGGTCCAGGGGT CTTACTCC

Table 2

STAMP1/STEAP2 promoter region response element sequence

Further Information	Opt.	Position	Str.	Core Sim.	Matrix Sim.	Sequence
NF-kappaB (p50)	0.83	315 - 327	(+)	1.000	0.994	cagGGGAtcccct
NF-kappaB (p50)	0.83	316 - 328	(−)	1.000	0.994	cagGGGAtcccct
NF-kappaB	0.82	510 - 522	(+)	1.000	0.862	gaGGGAgttttca
Tumor Suppressor p53	0.66	527 - 547	(−)	0.750	0.671	taaAATGttcggaaatgccct
Tumor Suppressor p53	0.66	528 - 548	(+)	0.750	0.689	gggCATTtccgaacattttat
Tumor Suppressor p53	0.66	1083 - 1103	(−)	0.750	0.676	ctgCGTGcccggacagctcgt

Important Note: In all gene silencing-siRNA experiments, inductions were initiated within the last 2 hours of transfection time.

Following transfection, induction of apoptosis and confirmation of their

Table 3

Stimuli and processes known to influence STAMP1 expression

Stimuli/Disease/Process	Effect	Tissue-cell Line
Cancer	Increase	Prostate Cancer
Adipogenesis	Decrease	3T3-L1 Murine Preadipocytes, Murine Mesenchymal Stem Cell
TNF-alpha	Decrease	LNCaP Cell Line
Androgen Receptor	Sustain	Prostate Cancer Cell Lines

expression RNA isolations from cells (RNeasy, QIAGEN) were performed. RNA samples are complementary DNA-cDNA synthesis (cDNA Synthesis Kit, Roche) was performed. Conventional PCR (MasterMix, Qiagen) once again confirmed the existence of STAMP genes.

A test containing apoptotic and anti-apoptotic genes by uptake of STAMP gene amplifications, RT-PCR in apoptosis panel (LC480, Roche-Ege University, Faculty of Engineering, Bioengineering Department) application was made.

5. Discussion

Prostate cancer is the second most common type of cancer in men worldwide today. Despite advances in diagnosis, follow-up and treatment, prostate cancer is a highly heterogeneous disease. STAMP1 is extensively expressed in normal and malignant prostate cells (see Table 3). It is usually associated with the trans-Golgi network in the plasma membrane of prostate epithelial cells and the Golgi complex. Apart from the prostate, STAMP1 is found in the heart, brain, pancreas, ovary, skeleton, muscle, mammary gland, testis, uterus, kidney, lung, trachea, and liver. No reduction in STAMP1 levels occurred after castration in androgen-dependent CWR22 tumors in mice. STAMP1 expression is unaffected by androgen stimulation, but responds to the androgen receptor. STAMP1 is localized in the cytosol and cell membrane of prostate epithelial cells. Knockout of the STAMP1 gene in mice results in a dramatic reduction in tumor size. Studies suggest that STAMP1 may be an important target in new treatment strategies.

By regulating some genes involved in the cell cycle, STAMP1 causes cycle arrest in the G₀ - G₁ phase. The proliferative activities of STAMP1 appear to be related to the ERK (extracellular signal-regulated kinase) pathway.

Other members of the STAMP family include pHyde, a rat homologue that has been implicated in the apoptosis of prostate cancer cells [16], and its human homologue TSAP6 (also known as STEAP3), a p53-inducible gene involved in apoptosis and the cell cycle in prostate cancer and HeLa cells [17].

Studies reported that STAMP family members have metalloreductase activities associated with iron and copper uptake into HEK-293T cells [18], though mentioned activities have been shown for prostate cells [19].

Although STAMP1/STEAP2 gene promoter region does not have Androgen Receptor Response Element (ARRE), the second identified STAMP2/STEAP4 gene has ARRE and is shown by ChIP. As a final point, both genes have a p53 response element, but siSTAMP1/STEAP2 application causes p53 gene: GENOME GARDİAN up-regulation.

Funding

This study was supported by grants from the Scientific and Technological Research Council of Türkiye (TUBITAK) to CGK (Grant no.: 106S295) and the Turkish Academy of Sciences (TUBA) to CGK (GEBIP-2007).

Conflicts of Interest

The author declares no conflicts of interest regarding the publication of this paper.

Appendix

AR Androgen Receptor

ARRE Androgen Receptor Response Element

ChIP Chromatine Immunoprecipitation

LNCaP Prostate Adenocarcinoma, Lymph Node Metastatic Site

MDM2 E3 Ubiquitin Ligase

NFkB Nuclear Factor Kappa B

siRNA Small Interfering RNA

STEAP Six Transmembrane Epithelial Antigen of Prostate

STAMP Six Transmembrane Protein of Prostate

RTqPCR Quantitative Polymerase Chain Reaction

TUBA Turkish Academy of Sciences

TUBITAK Scientific and Technological Research Council of Türkiye

References

1. Huggins, C. and Hodges, C.V. (1941) Studies on Prostatic Cancer. I. The Effect of Castration, of Estrogen and of Androgen Injection on Serum Phosphatases in Metastatic Carcinoma of the Prostate. Cancer Research, 1, 293-297.

2. Crawford, E.D., Rosenblum, M., Ziada, A.M. and Lange, P.H. (1999) Overview: Hormone Refractory Prostate Cancer. Urology, 54, 1-7. https://doi.org/10.1016/S0090-4295(99)00447-1

3. Stephan, C., Jung, K., Lein, M., Schnorr, D. and Loening, S.A. (2000) Re: Complexed Prostate Specific Antigen Provides Significant Enhancement of Specificity Compared with Total Prostate Specific Antigen for Detecting Prostate Cancer. Journal of Urology, 164, 1671-1672. https://doi.org/10.1016/S0022-5347(05)67079-6

4. Rittenhouse, H.G., Finlay, J.A., Mikolajczyk, S.D. and Partin, A.W. (1998) Human Kallikrein 2 (hK2) and Prostate-Specific Antigen (PSA): Two Closely Related, but Distinct, Kallikreins in the Prostate. Critical Reviews in Clinical Laboratory Sciences, 35, 275-368. https://doi.org/10.1080/10408369891234219

5. Stephenson, S.-A., Verity, K., Ashworth, L.K. and Clements, J.A. (1999) Localization of a New Prostate-Specific Antigen-Related Serine Protease Gene, KLK4, Is Evidence for an Expanded Human Kallikrein Gene Family Cluster on Chromosome 19q13.3-13.4. JBC: Journal of Biological Chemistry, 274, 23210-23214. https://doi.org/10.1074/jbc.274.33.23210

6. Yousef, G.M., Scorilas, A. and Diamandis, E.P. (2000) Genomic Organization, Mapping, Tissue Expression, and Hormonal Regulation of Trypsin-Like Serine Protease (TLSP PRSS20), a New Member of the Human Kallikrein Gene Family. Genomics, 63, 88-96. https://doi.org/10.1006/geno.1999.6072

7. Bieberich, C.J., Fujita, K., He, W.-W. and Jay, G. (1996) Prostate-Specific and Androgen-Dependent Expression of a Novel Homeobox Gene. JBC: Journal of Biological Chemistry, 271, 31779-31782. https://doi.org/10.1074/jbc.271.50.31779

8. He, W.W., Sciavolino, P.J., Wing, J., Augustus, M., Hudson, P., Meissner, P.S., Curtis, R.T., Shell, B.K., Bostwick, D.G., Tindall, D.J., Gelmann, E.P., Abate-Shen, C. and Carter, K.C. (1997) A Novel Human Prostate-Specific, Androgen-Regulated Homeobox Gene (NKX3.1) That Maps to 8p21, a Region Frequently Deleted in Prostate Cancer. Genomics, 43, 69-77. https://doi.org/10.1006/geno.1997.4715

9. Srikantan,V., Zou,Z.Q., Petrovics, G., Xu, L., Augustus, M., Davis, L., Livezey, J.R., Connell, T., Sesterhenn, I.A. Yoshino, K., Buzard, G.S., Mostofi, F.K., McLeod, D.G., Moul, J.W. and Srivastava, S. (2000) PCGEM1, a Prostate-Specific Gene, Is Overexpressed in Prostate Cancer. Proceedings of the National Academy of Sciences of the United States of America, 97, 12216-12221. https://www.jstor.org/stable/123817

10. Korkmaz, K.S., Korkmaz, C.G., Ragnhildstveit, E., Pretlow, T.G. and Saatcioglu, F. (2000) An Efficient Procedure for Cloning Hormone-Responsive Genes from a Specific Tissue. DNA and Cell Biology, 19, 499-506. https://doi.org/10.1089/10445490050128421

11. Nelson, P.S., Clegg, N., Arnold, H., Ferguson, C., Bonham, M., White, J., Hood, L. and Lin, B.Y. (2002) The Program of Androgen-Responsive Genes in Neoplastic Prostate Epithelium. Proceedings of the National Academy of Sciences of the United States of America, 99, 11890-11895. https://doi.org/10.1073/pnas.182376299

12. Korkmaz, K.S., Elbi, C., Korkmaz, C.G., Loda, M., Hager, G.L. and Saatcioglu, F. (2002) Molecular Cloning and Characterization of STAMP1, a Highly Prostate-Specific Six Transmembrane Protein that Is Overexpressed in Prostate Cancer. Journal of Biological Chemistry, 277, 36689-36696. https://doi.org/10.1074/jbc.M202414200

13. Galluzzi, L., Morselli, E., Kepp, O., Tajeddine, N. and Kroemer, G. (2008) Targeting p53 to Mitochondria for Cancer Therapy. Cell Cycle, 7, 1949-1955. https://doi.org/10.4161/cc.7.13.6222

14. Korkmaz, C.G., Korkmaz, K.S., Kurys, P., Elbi, C., Wang, L., Klokk, T.I., Hammarstrom, C., Troen, G., Svindland, A., Hager, G.L. and Saatcioglu, F. (2005) Molecular Cloning and Characterization of STAMP2, an Androgen-Regulated Six Transmembrane Protein That Is Overexpressed in Prostate Cancer. Oncogene, 24, 4934-4945. https://doi.org/10.1038/sj.onc.1208677

15. Wang, L., Jin, Y., Arnoldussen, Y.J., Jonson, I., Qu, S., Maelandsmo, G.M., Kristian, A., Risberg, B., Waehre, H., Danielsen, H.E. and Saatcioglu, F. (2010) STAMP1 Is Both a Proliferative and an Antiapoptotic Factor in Prostate Cancer. Cancer Research, 70, 5818-5828. https://doi.org/10.1158/0008-5472.CAN-09-4697

16. Steiner, M.S., Zhang, X., Wang, Y. and Lu, Y. (2000) Growth Inhibition of Prostate Cancer by an Adenovirus Expressing a Novel Tumor Suppressor Gene, pHyde. Cancer Research, 60, 4419-4425.

17. Passer, B.J. Nancy-Portebois, V., Amzallag, N., Prieur, S., Cans, C., De Climens, A.R., Fiucci, G., Bouvard, V., Tuynder, M., Susini, L., Morchoisne, S., Crible, V., Lespagnol, A. Dausset, J., Oren, M., Amson, R. and Telerman, A. (2003) The p53-Inducible TSAP6 Gene Product Regulates Apoptosis and the Cell Cycle and Interacts with Nix and the Myt1 Kinase. Proceedings of the National Academy of Sciences of the United States of America, 100, 2284-2289. https://doi.org/10.1073/pnas.0530298100

18. Ohgami, R.S., Campagna, D.R., McDonald, A. and Fleming, M.D. (2006) The Steap Proteins are Metalloreductases. Blood, 108, 1388-1394. https://doi.org/10.1182/blood-2006-02-003681

19. Grunewald, T.G.P., Bach, H., Cossarizza, A. and Matsumoto, I. (2012) The STEAP Protein Family: Versatile Oxidoreductases and Targets for Cancer Immunotherapy with Overlapping and Distinct Cellular Functions. Biology of the Cell, 104, 641-657. https://doi.org/10.1111/boc.201200027