<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJOph</journal-id><journal-title-group><journal-title>Open Journal of Ophthalmology</journal-title></journal-title-group><issn pub-type="epub">2165-7408</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojoph.2023.131010</article-id><article-id pub-id-type="publisher-id">OJOph-123208</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  Prevalence of Myocilin Gene Mutation in Adult-Onset Primary Open Angle Glaucoma and Non-Glaucoma Subjects Who Are Indigenes of Rivers State, Nigeria
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Azubuike</surname><given-names>Alfred Onua</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chinyere</surname><given-names>Nnenne Pedro-Egbe</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>School of Public Health, University of Port Harcourt, Port Harcourt, Nigeria</addr-line></aff><aff id="aff2"><addr-line>Department of Ophthalmology, University of Port Harcourt, Port Harcourt, Nigeria</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>01</month><year>2023</year></pub-date><volume>13</volume><issue>01</issue><fpage>91</fpage><lpage>105</lpage><history><date date-type="received"><day>30,</day>	<month>December</month>	<year>2022</year></date><date date-type="rev-recd"><day>20,</day>	<month>February</month>	<year>2023</year>	</date><date date-type="accepted"><day>23,</day>	<month>February</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background: Glaucoma is the leading cause of irreversible blindness incapacitating over 80 million people worldwide. Several pathogenetic mechanisms have been postulated to explain the optic nerve damage that occur in POAG among which genetic predisposition is prominent. Gene-Linkage-based studies have identified genes associated with POAG: Myocilin, Optineurin, WDR36, Tank-Binding Kinase (TBK1) and APbb-2. 
  Objective: To investigate the prevalence of myocilin gene mutation in adult-onset POAG patients and non-glaucoma subjects who are indigenes of Rivers State. 
  Methodology: In this comparative cross-sectional study, 393 POAG patients attending the Glaucoma Clinic of UPTH were compared with 393 age and sex-matched phenotypically normal participants. Clinical assessment combined with findings from clinical records was used. Venous blood was obtained for genomic analyses. Extracted DNA was sequenced with specific primers for myocilin and polymerase chain reaction. Zymo-Bead Genomic DNA kit protocol was used to detect allelic differences. 
  Results: Total of 786 participants participated in the study. The mean age was 59.8 &#177; 11.8 years. The prevalence of myocilin gene mutation (MYOC) in the study population was 5.3%, in the POAG group was 8.4%, and 2.3% in the non-glaucoma group. This observed difference was statistically significant (p = 0.001). Location of the mutant myocilin gene was in GLC1A 171638779, 171638703, 171638610 and 171638608. 
  Conclusion: Mutations in myocilin gene are associated with adult-onset POAG in Rivers State. Its relevance as a biomarker for diagnosis of adult-onset POAG needs further investigations.
 
</p></abstract><kwd-group><kwd>Prevalence</kwd><kwd> Myocilin Gene Mutation</kwd><kwd> Adult-Onset Primary Open Angle Glaucoma</kwd><kwd> Rivers State Indigenes</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Glaucoma is a prominent cause of irreversible blindness worldwide and in Nigeria, accounting for 15% - 20% of blindness in Nigeria [<xref ref-type="bibr" rid="scirp.123208-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref3">3</xref>] . Individuals of African ancestry are more affected by primary open angle glaucoma than their Caucasian counterparts (possibly due to genetic predisposition), and are more likely to have worse progression and prognosis [<xref ref-type="bibr" rid="scirp.123208-ref4">4</xref>] .</p><p>Several pathogenetic mechanisms have been postulated to explain the optic nerve damage that occurs in primary open-angle glaucoma. However, no single mechanism can adequately explain the great variations in susceptibility to damage and the patterns of damage seen in this disease. The etiology of POAG is likely to be multifactorial; genetic, mechanical, vascular and other interwoven factors are said to influence individual susceptibility to optic nerve damage [<xref ref-type="bibr" rid="scirp.123208-ref5">5</xref>] .</p><p>Genetical predisposition has been shown to play an important role in the pathogenesis of POAG [<xref ref-type="bibr" rid="scirp.123208-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref7">7</xref>] . Many gene linkage-based studies have identified several genes and their mutations contributing in varying proportions to Primary Open Angle Glaucoma. These include the myocilin, optineurin, WDR36, threonine protein binding kinase-1(TANK-1) and amyloid-β a4 precursor protein- binding family B member 2 (APbb-2) [<xref ref-type="bibr" rid="scirp.123208-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref9">9</xref>] .</p><p>The major genetic etiopathogenetic component of POAG among sub-Saharan African populations continues to draw the interest of several researchers. However, some evidences have emanated which strongly link mutations in myocilin and APbb-2 genes.</p><p>Myocilin is a glycoprotein composed of 504 amino acids with a molecular weight of 55-57 kDa [<xref ref-type="bibr" rid="scirp.123208-ref10">10</xref>] . It is found in the ciliary body, Golgi apparatus of corneal fibroblasts, Schlemm’s canal endothelial cells, trabecular meshwork, lamina cribrosa, retina, optic nerve, aqueous and vitreous humor of the eye. Outside the eye, expression of myocilin is found in the skeletal muscle, heart, breast, small intestine, prostate, testis, colon, stomach, thyroid, trachea, bone marrow, and brain. Myocilin has also been detected in Schwann cells, myelin sheath of peripheral nerves, renal podocytes, mesangial cells, intervertebral disks, and plasma. The precise function of myocilin is unknown. However, scientific research has linked it to other proteins, making it part of a protein complex. For instance, the isoform of the cytochrome P450 protein has shown interaction with myocilin. Many scientists believe that myocilin has a role in cytoskeletal function [<xref ref-type="bibr" rid="scirp.123208-ref7">7</xref>] .</p><p>Myocilin was first identified as a glaucoma gene in 1997 and its mutations are the most common cause of glaucoma with a known molecularly defined basis [<xref ref-type="bibr" rid="scirp.123208-ref7">7</xref>] . Myocilin protein is produced by many healthy ocular tissues and secreted into the aqueous humor. However, accumulation of abnormal myocilin protein produced by myocilin mutations is toxic to the trabecular meshwork resulting in poor egress of aqueous humor and elevation in IOP often leading to glaucomatous damage of the optic nerve head [<xref ref-type="bibr" rid="scirp.123208-ref11">11</xref>] .</p><p>Significant prevalence of mutation in myocilin gene mutation could be used as a biomarker in the screening and detection of the population for POAG; hence this work is on the prevalence of myocilin gene mutation in adult-onset Primary Open Angle Glaucoma and non-glaucoma phenotypically normal subjects who are indigenes of Rivers Staten, Nigeria.</p></sec><sec id="s2"><title>2. Materials and Methods</title><p>This was a comparative cross-sectional study of 393 known Adult-onset Primary Open Angle glaucoma patients attending the Glaucoma Clinic of the University of Port Harcourt Teaching Hospital with 393 age and sex-matched phenotypically normal indigenes of Rivers State, were recruited via multi-stage sampling technique from different parts of the State. The study was conducted between January 2021 and November 2022. Clinical assessment combined with findings from clinical records was used. Subjects with history of eye surgery prior to diagnosis of glaucoma, cases of secondary glaucoma, angle-closure glaucoma, history of ocular trauma, or history of significant use of systemic or ocular glucocorticoids for a period exceeding 6 months were excluded from the study.</p></sec><sec id="s3"><title>3. Ethical Statement</title><p>Ethical approval to conduct this study was obtained from the Ethics Committee of University of Port Harcourt. This study adhered to the tenets of the Declaration of Helsinki on study involving human subjects. Study participants’ informed consents were obtained. Participation was absolutely voluntary. Participants were free to opt out at any stage of the study without victimization. All information obtained from the participants of this study was treated with utmost confidentiality. No personal identification (names, clinic number) was stored electronically. There was no health risk to the participants of this study. Benefits to the participants included free reading glasses, ocular assessment and counseling.</p></sec><sec id="s4"><title>4. Calculation of Sample Size</title><p>Minimum sample size estimation formula for comparing two proportions is that by Lwanga, SK.et al., [<xref ref-type="bibr" rid="scirp.123208-ref12">12</xref>] :</p><p>n = ( Z α / 2 + Z 1 − β ) 2 ( P 1 − P 2 ) 2 { P 1 ( 1 − P 1 ) + P 2 ( 1 − P 2 ) }</p><p>where:</p><p>&#183; n = minimum sample size in the 2 groups</p><p>&#183; Z<sub>α</sub><sub>/2 </sub>= standard normal deviate corresponding to 5% level of significance = 1.96</p><p>&#183; Z<sub>1</sub><sub>−</sub><sub>β</sub> = standard normal deviate corresponding to a power of 80% = 0.84</p><p>&#183; P<sub>1</sub> = 4.4% = 0.044</p><p>&#183; P<sub>2</sub> = 1% = 0.01</p><p>&#183; P<sub>1</sub> − P<sub>2</sub> = the smallest difference between the two groups of scientific or clinical importance which the study would not want to miss.</p><p>Substituting the values of Z<sub>α</sub><sub>/2</sub>,<sub> </sub>Z<sub>1</sub><sub>−</sub><sub>β</sub>, P<sub>1</sub> and P<sub>2</sub> in the formula:</p><p>n = ( 1.96 + 0.84 ) 2 ( 0.044 − 0.01 ) 2 { 0.044 ( 1 − 0.044 ) + 0.01 ( 1 − 0.01 ) }</p><p>n = 2.8 2 0.034 2 { 0.044 ( 0.956 ) + 0.01 ( 0.99 ) }</p><p>n = 7.84 0.001156 { 0.042064 + 0.0099 }</p><p>n = 6782.01 &#215; 0.051964</p><p>n = 352.4 ≈ 353</p><p>An adjustment is made for non-response rate of 10%. Non-Response Rate (NRR) accounts for households that could be either absent, not accessible, refuse to be surveyed or any other reason that prevent survey team from surveying a selected household.</p><p>FinalSampleSize ( N ) = n 1 − non-responserate = n 1 − 10 % = n 1 − 0.1 = 353 0.9 = 392.2 ≈ 393   personsineachgroup</p></sec><sec id="s5"><title>5. Eligibility Criteria</title><p>Inclusion Criteria</p><p>Patients diagnosed with primary open angle glaucoma who are indigenes of Rivers State.</p><p>Exclusion Criteria</p><p>Subjects with a history of eye surgery prior to diagnosis of glaucoma, cases of secondary glaucoma, angle-closure glaucoma, a history of ocular trauma, or a history of significant use of systemic or ocular glucocorticoids for a period exceeding 6 months (to avoid steroid-responders to increase in intraocular pressure.</p></sec><sec id="s6"><title>6. Sample and Data Analysis</title><sec id="s6_1"><title>6.1. Blood Sample Collection for Genetic Diagnostics</title><p>The cubital fossa of every study participant was prepared for phlebotomy. A nurse performed the phlebotomy. After informing the participant of the procedure and obtaining consent, a tourniquet was applied to the participant’s upper arm above the antecubital fossa, cleansed with an antiseptic solution (name) and three milliliters of peripheral venous blood were collected with a sterile needle and syringe and preserved in a specimen bottle containing an anticoagulant - ethylene-diamine-tetra-acetate (EDTA) for genetic analysis. The specimen bottles were correctly labelled with the participant’s serial number.</p></sec><sec id="s6_2"><title>6.2. Extraction of Deoxyribonucleic Acid (DNA) from the Blood Samples</title><p>&#183; DNA was extracted from the blood samples of study participants using Zymo-Bead Genomic DNA kit protocol. The procedure was as follows:</p><p>&#183; 50 &#181;l of blood sample was put in a clean, grease-free test tube.</p><p>&#183; To the above, 10 &#181;l Zymo-Bead slurry was added; that is re-suspended by vortexing.</p><p>&#183; 200 &#181;l of Genomic Lysis Buffer was then added and mixed by inversion and incubated at room temperature for 5 minutes. The content of the test tube was centrifuged at 1500 &#215; g for 1 minute and then carefully removed.</p><p>&#183; 20 &#181;l of Genomic Lysis Buffer was then added to the above. The mixture was re-suspended by pipetting up and down and centrifuged at 1500 &#215; g for 1 minute. The supernatant was then discarded.</p><p>&#183; 200 &#181;l of DNA Pre-Wash Buffer was added to the supernatant. The pellet was re-suspended and then centrifuged at 1500 &#215; g for 1 minute. The supernatant was discarded.</p><p>&#183; 500 &#181;l of g-DNA Wash Buffer was added to the supernatant above, to resuspend the pellet and then centrifuged at 1500 &#215; g for 1 minute. The supernatant was discarded and recentrifuged briefly to remove any residual wash buffer.</p><p>&#183; 35 &#181;l of Elution Buffer was added. The pellet was resuspended by pipetting up and down, and then centrifuged at 10,000 &#215; g for 1 minute.</p><p>&#183; The supernatant was then collected. The supernatant contains purified DNA that was used immediately or stored at −20˚C for later use.</p></sec><sec id="s6_3"><title>6.3. Gel Electrophoresis</title><p>The quality of DNA, the products of PCR were assessed using gel electrophoresis using a Portable Gel hood built in blue LED (470 nm) by Royal Biotech/Biolympics [<xref ref-type="bibr" rid="scirp.123208-ref13">13</xref>] . 1.5% agarose gel at a constant voltage and 1&#215; TBE for approximately 1 hour. They were visualized by ethidium bromide staining and photographed under ultraviolet light. The ladder used is 1 kb base pair ladder from thermos- scientific.</p></sec></sec><sec id="s7"><title>7. Polymerase Chain Reaction</title><p>Genomic DNA was extracted from the venous blood of all participants. Linkage analysis was performed with five microsatellite markers around the MYOC gene (Myo-IFa, Myo-IRa, Myo-2F, Myo-2R, Myo-3Fa and Myo-3Ra). Mutation screening of all coding exons of MYOC was performed by direct sequencing of PCR-amplified DNA fragments and restriction fragment length polymorphism (RFLP) analysis.</p><p>Polymerase chain reaction was carried out using specific primers (<xref ref-type="table" rid="table1">Table 1</xref>). A solution of DNA polymerase, dNTPs, reaction buffer and water assembled into 1.8 ml microcentrifuge tube. The premixed PCR Master Mix contained: 10&#215; PCR buffer, 25 mM Mgcl2, 5pMol forward primer, 5 pMol reverse primer, DMSO, 2.5 Mm DNTPs, Taq 5 u/ul and 10 ng/&#181;l DNA. A total of 25 &#181;L of the Master Mix was utilized. The amount of each reagent added to the Master Mix at optimal concentrations for effective amplification of DNA templates by PCR is presented in <xref ref-type="table" rid="table2">Table 2</xref>.</p><sec id="s7_1"><title>7.1. Cocktail Mix of DNA for PCR</title><p>A solution of DNA polymerase, dNTPs, reaction buffer and water assembled into 1.8 ml microcentrifuge tube. The premixed PCR Master Mix contained: 10&#215; PCR buffer, 25 mM MgCl<sub>2</sub>, 5pMol forward primer, 5 pMol reverse primer, DMSO, 2.5 Mm DNTPs, Taq 5 u/ul and 10 ng/&#181;l DNA (<xref ref-type="table" rid="table2">Table 2</xref>). A total of 25 &#181;L of the Master Mix was utilized. The amount of each reagent added to the Master Mix at optimal concentrations for effective amplification of DNA templates by PCR is presented in <xref ref-type="table" rid="table2">Table 2</xref>.</p><p>The above cocktail mix of DNA and conditions for the PCR were utilized.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences for myocilin gene polymerase chain reaction</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer Name</th><th align="center" valign="middle" >Primer Sequence</th><th align="center" valign="middle" >Amplified Sequence Length</th></tr></thead><tr><td align="center" valign="middle" >Myo-1Fa</td><td align="center" valign="middle" >5’-CCTCACGTGGCCACCTCTGTC-3’</td><td align="center" valign="middle" >554 bp</td></tr><tr><td align="center" valign="middle" >Myo-1Ra</td><td align="center" valign="middle" >5’-GGTTTCCAGCTGGTCCCGCTC-3’</td><td align="center" valign="middle" >554 bp</td></tr><tr><td align="center" valign="middle" >Myo-2F</td><td align="center" valign="middle" >5’-GCCGGCAGCCTATTTAAATGTC-3’</td><td align="center" valign="middle" >404 bp</td></tr><tr><td align="center" valign="middle" >Myo-2R</td><td align="center" valign="middle" >5’-CCTGCTCTGACAAGGGAACAG-3’</td><td align="center" valign="middle" >404 bp</td></tr><tr><td align="center" valign="middle" >Myo-3Fa</td><td align="center" valign="middle" >5’-GCTGTCACATCTACTGGCTCTG–3’</td><td align="center" valign="middle" >736 bp</td></tr><tr><td align="center" valign="middle" >Myo-3Ra</td><td align="center" valign="middle" >5’-GTCATAAGCAAAGTTGACGGTAGC-3’</td><td align="center" valign="middle" >736 bp</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Cocktail mix of DNA for PCR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >10&#215; PCR buffer</th><th align="center" valign="middle" >2.5</th></tr></thead><tr><td align="center" valign="middle" >25 mM MgCl<sub>2</sub></td><td align="center" valign="middle" >1.0</td></tr><tr><td align="center" valign="middle" >5 pMol forward primer</td><td align="center" valign="middle" >1.0</td></tr><tr><td align="center" valign="middle" >5 pMol reverse primer</td><td align="center" valign="middle" >1.0</td></tr><tr><td align="center" valign="middle" >DMSO</td><td align="center" valign="middle" >1.0</td></tr><tr><td align="center" valign="middle" >2.5 Mm DNTPs</td><td align="center" valign="middle" >2.0</td></tr><tr><td align="center" valign="middle" >Taq 5 u/ul</td><td align="center" valign="middle" >0.1</td></tr><tr><td align="center" valign="middle" >10 ng/&#181;l DNA</td><td align="center" valign="middle" >3.0</td></tr><tr><td align="center" valign="middle" >H<sub>2</sub>O</td><td align="center" valign="middle" >13.4</td></tr><tr><td align="center" valign="middle" >TOTAL</td><td align="center" valign="middle" >25 &#181;L</td></tr></tbody></table></table-wrap></sec><sec id="s7_2"><title>7.2. Touchdown PCR Protocol Used for the Primers</title><p>This is a method for increasing specificity of PCR reactions. In this procedure, 9 cycling program was used initially and then 35 cycling programs for the annealing temperature and gradually reduced at 1˚C/every second cycle. The initial annealing temperature was 94˚C and final temperature was 72˚C (<xref ref-type="table" rid="table3">Table 3</xref>).</p></sec><sec id="s7_3"><title>7.3. DNA Sequencing</title><p>The polymerase chain reaction (PCR) products, free of contaminating bands due to non-specific amplification, was sent to the International Institute for Tropical Agriculture (IITA) Ibadan, Nigeria for bi-directional sequencing using an ABI Prism 3500 DNA sequencer with dye-termination chemistry. A 96 well plate was used for cycle sequencing and the products were purified using Ethanol/EDTA precipitation method. 25ng of the PCR product was used to perform cycle sequencing.</p><p>Nucleotide changes was detected by identifying double peaks in the chromatogram due to heterozygosity of the DNA sample analyzed and confirmed by sequencing from the opposite direction. In addition, the sequences were analyzed using Pairwise BLAST to determine if there were any changes from the normal sequence available in the database.</p></sec><sec id="s7_4"><title>7.4. Restriction Enzyme Digestion</title><p>Mutations identified by DNA sequencing was screened in additional POAG patients and control samples by PCR amplifying the suspected region of genomic DNA (<xref ref-type="table" rid="table4">Table 4</xref>). The PCR products were digested with appropriate restriction</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Touchdown PCR condition</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Initial den.</th><th align="center" valign="middle"  colspan="3"  >9 Cycle</th><th align="center" valign="middle"  colspan="3"  >35 Cycles</th><th align="center" valign="middle"  rowspan="2"  >Final extension</th><th align="center" valign="middle"  rowspan="2"  >Hold Temp.</th></tr></thead><tr><td align="center" valign="middle" >Den.</td><td align="center" valign="middle" >Ann. Temp.</td><td align="center" valign="middle" >extension</td><td align="center" valign="middle" >Den.</td><td align="center" valign="middle" >Ann. Temp.</td><td align="center" valign="middle" >extension</td></tr><tr><td align="center" valign="middle" >94˚C</td><td align="center" valign="middle" >94˚C</td><td align="center" valign="middle" >65˚C</td><td align="center" valign="middle" >72˚C</td><td align="center" valign="middle" >94˚C</td><td align="center" valign="middle" >55˚C</td><td align="center" valign="middle" >72˚C</td><td align="center" valign="middle" >72˚C</td><td align="center" valign="middle" >10˚C</td></tr><tr><td align="center" valign="middle" >5 min</td><td align="center" valign="middle" >15 sec</td><td align="center" valign="middle" >20 sec</td><td align="center" valign="middle" >30 sec</td><td align="center" valign="middle" >15 sec</td><td align="center" valign="middle" >20 sec</td><td align="center" valign="middle" >30 sec</td><td align="center" valign="middle" >7 min</td><td align="center" valign="middle" >∞</td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Mutation screening by allele specific restriction digestion</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Nucleotide change</th><th align="center" valign="middle" >Amino acid change</th><th align="center" valign="middle" >Location</th><th align="center" valign="middle" >Sequence of primer pairs (5’ to 3’) and PCR condition</th><th align="center" valign="middle" >Length of PCR product (bp)</th></tr></thead><tr><td align="center" valign="middle" >144 G-&gt;T</td><td align="center" valign="middle" >Gln48His</td><td align="center" valign="middle" >Exon 1</td><td align="center" valign="middle" >CTTCTGTGCACGTTGCTGCA CTGGTCCAAGGTCAATTGGT 94˚C 30 s, 52˚C 30 s, 72˚C 60 s for 30 cycles using 1 mM MgCl<sub>2</sub></td><td align="center" valign="middle" >313</td></tr><tr><td align="center" valign="middle" >1109 C-&gt;T</td><td align="center" valign="middle" >Pro370Leu</td><td align="center" valign="middle" >Exon 3</td><td align="center" valign="middle" >ATACTGCCTAGGCCACTGGA CAATGTCCGTGTAGCCACC 94˚C 30 s, 58˚C 30 s, 72˚C 60 s for 35 cycles using 1 mM MgCl<sub>2</sub></td><td align="center" valign="middle" >198</td></tr></tbody></table></table-wrap><p>enzymes that distinguished between the mutant and normal alleles (<xref ref-type="table" rid="table3">Table 3</xref>) under the conditions described by the manufacturer (New England BioLabs, Beverly, MA) in a total reaction volume of 20 mls. Similarly, single nucleotide polymorphisms in the promoter region (pSNP) and coding sequence (cSNP) were screened in both patient and control samples using Ava I and BsmA I restriction enzymes. DNA fragments in the digest was separated by electrophoresis in 6% polyacrylamide gels, stained with ethidium bromide and visualized using an UV transilluminator. Alleles were scored based on the DNA band patterns in the gel.</p></sec><sec id="s7_5"><title>7.5. Mutation Screening by Allele Specific Restriction Digestion</title><p>Several restriction endonucleases were utilized to digest the nucleic acids and detect specific sequences of nucleotides in a DNA strand, thereby enabling the recognition of point mutations in DNA and eliminates the need for subcloning and sequencing (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec><sec id="s7_6"><title>7.6. Detection of Mutations/Single Nucleotide Polymorphism (SNPs)</title><p>Bioedit was used to trim and edit the sequences. Bioedit and Clustal X were used for Single Nucleotide Polymorphisms (SNPs) detection using reference sequences downloaded from genbank [<xref ref-type="bibr" rid="scirp.123208-ref14">14</xref>] . Ensembl were used to predict the effect of the Single Nucleotide Polymorphisms (SNPs).</p></sec><sec id="s7_7"><title>7.7. Data Analysis</title><p>The data obtained were entered into Microsoft Excel sheet, cleansed and later exported to IBM Statistical Package for Social Sciences (SPSS) version 25 software (SPSS) Inc; Chicago, IL, USA for statistical analysis. Relevant data were presented in tables and charts. Statistical significance was performed using Chi square and statistical significance was set at p ≤ 0.05. Zymo-Bead Genomic DNA kit protocol (YeaStar Genomic DNA Kit-D2002) [<xref ref-type="bibr" rid="scirp.123208-ref15">15</xref>] was used to detect allelic differences.</p></sec></sec><sec id="s8"><title>8. Results</title><p>The study participants were 786 subjects; there were 393 adult-onset primary open angle glaucoma (POAG) patients and 386 non-glaucoma subjects, all indigenes of Rivers State. Fifty percent (n = 393) of the study subjects were established adult-onset POAG patients while 50% (n = 393) were age and sex- matched non-glaucoma phenotypically normal subjects. The male to female ratio was 1:1, with a mean age in both groups of 59.8 &#177; 11.8 years, and an age range of 40 to 86 years. The modal age was 60 - 69 accounting for 14.9% of the study population in each of the two groups. The difference in the ages of the participants in the two groups was not statistically significant (p = 1.000) (<xref ref-type="table" rid="table5">Table 5</xref>). The participants of this study were from the following ethnic groups in Rivers State, Nigeria: Andoni, Ekpeye, Engenni, Etche, Igbani, Ikwerre, Kalabari, Ogba, Okrika, and Ogoni with equal number of participants represented from each participating Local Government Area.</p><sec id="s8_1"><title>8.1. Educational Status of the Study Subjects</title><p>Over 13% of study participants in the POAG group had tertiary education compared to 4% in the non-glaucoma group; 23.9% of the study participants in the POAG group had secondary education compared to 7.4% in the non-glaucoma group. Only 1.5% of study participants in the POAG group had no formal education compared to 25.2% in the non-glaucoma group. The difference in the distribution of the study participants according to their educational status was statistically significant (p = 0.000) (<xref ref-type="table" rid="table6">Table 6</xref>).</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> Age-Gender characteristics of the study population</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Variables</th><th align="center" valign="middle"  colspan="2"  >Distribution in Adult onset POAG cases n = 393</th><th align="center" valign="middle"  colspan="2"  >Distribution in Normal subjects n = 393</th><th align="center" valign="middle"  rowspan="2"  >Total</th><th align="center" valign="middle"  rowspan="2"  >(%)</th><th align="center" valign="middle"  rowspan="2"  >Chi-Square Value</th><th align="center" valign="middle"  rowspan="2"  >p-Value</th></tr></thead><tr><td align="center" valign="middle" >(n)</td><td align="center" valign="middle" >(%)</td><td align="center" valign="middle" >(n)</td><td align="center" valign="middle" >(%)</td></tr><tr><td align="center" valign="middle" >Gender Male Female</td><td align="center" valign="middle" >197 196</td><td align="center" valign="middle" >(25.1) (24.9)</td><td align="center" valign="middle" >196 197</td><td align="center" valign="middle" >(24.9) (25.1)</td><td align="center" valign="middle" >393 393</td><td align="center" valign="middle" >(50) (50)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >786</td><td align="center" valign="middle" >(100)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Age Group (Years) 40 - 49 50 - 59 60 - 69 70 - 79 80 - 89</td><td align="center" valign="middle" >91 108 117 48 29</td><td align="center" valign="middle" >(11.6) (13.7) (14.9) (6.1) (3.7)</td><td align="center" valign="middle" >91 108 117 48 29</td><td align="center" valign="middle" >(11.6) (13.7) (14.9) (6.1) (3.7)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >786</td><td align="center" valign="middle" >(100)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  >Mean age = 59.8 &#177; 11.8</td><td align="center" valign="middle"  colspan="2"  >Age Range 40 to 86 years</td><td align="center" valign="middle"  colspan="2"  ></td><td align="center" valign="middle" >0.000</td><td align="center" valign="middle" >1.000</td></tr></tbody></table></table-wrap><table-wrap id="table6" ><label><xref ref-type="table" rid="table6">Table 6</xref></label><caption><title> Educational status of the study subjects</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Variables (Educational Status)</th><th align="center" valign="middle"  colspan="2"  >Distribution in Adult onset POAG cases n = 393</th><th align="center" valign="middle"  colspan="2"  >Distribution in Normal subjects n = 393</th><th align="center" valign="middle"  rowspan="2"  >Total</th><th align="center" valign="middle"  rowspan="2"  >(%)</th><th align="center" valign="middle"  rowspan="2"  >Chi-Square Value</th><th align="center" valign="middle"  rowspan="2"  >p-Value</th></tr></thead><tr><td align="center" valign="middle" >(n)</td><td align="center" valign="middle" >(%)</td><td align="center" valign="middle" >(n)</td><td align="center" valign="middle" >(%)</td></tr><tr><td align="center" valign="middle" >Tertiary Secondary Primary No Formal Education</td><td align="center" valign="middle" >106 188 87 12</td><td align="center" valign="middle" >(13.5) (23.9) (11.1) (1.5)</td><td align="center" valign="middle" >32 58 105 198</td><td align="center" valign="middle" >(4.1) (7.4) (13.3) (25.2)</td><td align="center" valign="middle" >138 246 192 210</td><td align="center" valign="middle" >(17.6) (31.3) (24.4) (26.7)</td><td align="center" valign="middle" >274.84</td><td align="center" valign="middle" >0.000</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >(50)</td><td align="center" valign="middle" >786</td><td align="center" valign="middle" >(100)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap></sec><sec id="s8_2"><title>8.2. Occupational Status of the Adult-Onset POAG Patients</title><p>Majority of the study participants in the adult-onset POAG group (30.0%) were retired civil servants; 23% were engaged in public service, 21% were engaged in diverse businesses and trading activities; 8% were artisans, 6% (fishing), 5% farming, 4% were full time housewives and 3% were unemployed (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec><sec id="s8_3"><title>8.3. Occupational Status of the Phenotypically Normal Non-Glaucoma Subjects</title><p>In the phenotypically normal non-glaucoma group, 22% were engaged in fishing, 20% in farming, 14% were retired public servants; 13% were public servants; 13% were unemployed, 8% were full time housewives; 6% were engaged in diverse businesses and trading activities while 4% were artisans (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s8_4"><title>8.4. Prevalence of Mutation in the Myocilin Gene among in the Two Groups</title><p>Prevalence of Myocilin gene mutation on the total population studied was 5.3%; 8.4% among adult-onset POAG group and 2.3% in the phenotypical, normal non-glaucoma group (<xref ref-type="table" rid="table7">Table 7</xref>). The difference in the prevalence in myocilin gene mutation in the groups was statistically significant (p = 0.001).</p></sec></sec><sec id="s9"><title>9. Discussion</title><p>This study sets out to study the prevalence of myocilin mutant gene among adult-onset primary open angle glaucoma (POAG) patients and non-glaucoma phenotypically normal subjects, who are indigenes of Rivers State.</p><p>Adult-onset primary open-angle glaucoma occurs from the age of 40 years [<xref ref-type="bibr" rid="scirp.123208-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.123208-ref18">18</xref>] . The age range of our study participants was 40 to 86 years with a</p><table-wrap id="table7" ><label><xref ref-type="table" rid="table7">Table 7</xref></label><caption><title> Prevalence of mutation in the myocilin gene among in the two groups</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Mutation in Myocilin gene PRESENT</th><th align="center" valign="middle" >Mutation in Myocilin gene ABSENT</th><th align="center" valign="middle" >TOTAL</th><th align="center" valign="middle" >Prevalence</th></tr></thead><tr><td align="center" valign="middle" >POAG patients Group</td><td align="center" valign="middle" >33</td><td align="center" valign="middle" >360</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >8.4%</td></tr><tr><td align="center" valign="middle" >Non-Glaucoma Group</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >384</td><td align="center" valign="middle" >393</td><td align="center" valign="middle" >2.3%</td></tr><tr><td align="center" valign="middle" >TOTAL</td><td align="center" valign="middle" >42</td><td align="center" valign="middle" >744</td><td align="center" valign="middle" >786</td><td align="center" valign="middle" >5.3%</td></tr></tbody></table></table-wrap><p>Pearson Chi-Square Test = 14.488; p-value = 0.001.</p><p>mean age of 59.8 &#177; 11.8 years in both groups. The modal age group (60 - 69) accounted for 14.9%. This observation compares well with the study of Kyari et al., in the Nigerian National Blindness and Visual Impairment Survey of 2005-2007. In their study, a sample of 13,591 people aged ≥ 40 years, representative Nigerian-nationals: the mean age of the subjects with POAG was 66.2 &#177; 12.3 years. Working independently and in different periods of time, Murdoch et al., in a study among 1563 people of Hausa/Fulani ethnic extraction of Nigeria; reported that POAG was more prevalent among individuals aged 45 years and older [<xref ref-type="bibr" rid="scirp.123208-ref19">19</xref>] while Adekoya in South Western region of Nigeria observed that POAG was more prevalent among individuals aged 50 years and older and that POAG accounted for 11.1% of blindness in Nigeria [<xref ref-type="bibr" rid="scirp.123208-ref20">20</xref>] . These studies of Kyari et al., Awoyesuku et al., Murdoch et al. and Adekoya were population-based studies with large sample sizes, independently done at different periods in similar socio-cultural background and similar results, thus giving credence to the assertion that adult-onset POAG occurring at ≥ 40 years.</p><p>Corroborating with our findings are the works of Leske et al., in the Barbados Eye Study which observed that adult-onset POAG was predominately among populations 45 years of age and older and that POAG significantly increases with age in all populations. It was also postulated that older black populations may exhibit a tendency to present with more advanced POAG at diagnosis, including severe optic nerve cupping and extensive visual field loss. This position, however, needs further investigation in our locality in Niger-Delta region, Nigeria [<xref ref-type="bibr" rid="scirp.123208-ref21">21</xref>] .</p><p>In this research, we recruited equal participants aged 40 years and older from both sexes and age-matched population of the same ethnic and socio-cultural background. This was deliberate as the study-design from the onset was intended to eliminate influences from differences in age, sex and racial identities in the two groups. Moreso, it was intended to make the comparative groups as similar in characteristic features as possible, thereby achieving some level of homogeneity.</p><p>Concerning the occupational distribution of the study population, majority of the study participants (21.8%) were retired civil servants with different levels of educational status. There was a statistically significant difference in the distribution of the participants in this study among the various occupational status (p = 0.000). The modal class of the study participants in our study was 60 - 69 years; most of them- retirees (15.1%). The distribution of the proportion of retired civil servants in the study population is in tandem that the retirement age from civil service in Nigeria is from 65 years (Federal Republic of Nigeria, Public Service Rules 2008); and that adult-onset POAG occur from 40 years and older.</p><p>The prevalence of mutation in myocilin gene in the study population was 5.3%. Among Adult-onset POAG group, the prevalence of myocilin gene mutation was 8.4% and among the control group 2.3%. This observed difference was statistically significant (p = 0.001).</p><p>Chi-Square Goodness of Fit Test was performed to determine if this observed difference in the prevalence was due to chance or not. Chi-Square Goodness of Fit Test establishes whether there is a discrepancy between the observed values and those expected of the model. The proportions did differ by the prevalence of mutations in myocilin gene between the POAG patients’ group and the non- glaucoma group. This observed difference was statistically significant (p = 0.001), implying that mutations in myocilin gene is likely to be associated with adult onset POAG.</p><p>Our findings in this study are in tandem with the findings of Challa et al., in Accra, Ghana. Challa et al. studied 90 adult-onset POAG patients with 70 age- matched controls and found that the prevalence of mutation in myocilin gene was 4.4%. Also, in their study it was observed that four individuals with severe POAG were found to have mutations in exon 3-Asp380Asn and Arg342Lys mutations which were not detected in the controls [<xref ref-type="bibr" rid="scirp.123208-ref22">22</xref>] . Our study population was larger than the study population of Challa et al., and probably could be responsible for their lower yield of the prevalence of mutations in myocilin gene among adult-onset POAG patients.</p><p>Our study corroborates with the findings of Fingert et al., in Iowa, United States of America where the prevalence of myocilin gene among African-American glaucoma population ranged between 2.8% and 5% among adult-onset POAG patients [<xref ref-type="bibr" rid="scirp.123208-ref7">7</xref>] . In the study, 1703 glaucoma patients from Australia, Japan, Canada, and the USA (Caucasians from Iowa and African Americans from New York City) were examined. This was a mixed-population cross sectional study with limited power, though with large number of study participants.</p><p>In another study, Fingert et al., observed a statistically significant association between mutation in myocilin gene and POAG by screening 330 POAG patients and 471 controls for myocilin mutations; they found mutations of myocilin in 3.9% of POAG patients and in 0.2% of the control subjects [<xref ref-type="bibr" rid="scirp.123208-ref23">23</xref>] .</p><p>Also, Ennis et al. in Southern England identified an overall prevalence of 2.2% in Caucasian POAG patients [<xref ref-type="bibr" rid="scirp.123208-ref24">24</xref>] . However, earlier studies by Fingert et al., in the year 1999 observed a prevalence of 2% - 4% in myocilin gene mutations in patients with Primary Open Angle Glaucoma (i.e., 4.3% in patients from Iowa, USA; 2.6 % in African Americans from New York; 2.8% in Japanese patients; 3.0% in Canadian patients; and 2.8% in Australian patients). Similar to other studies, our present finding was the disease-causing mutations detected in this population tended to occur in exon 3.</p><p>Our findings in this work are in agreement with the postulation that, mutations in myocilin gene are associated with adult-onset POAG and that the identified mutations are possible biogenetic markers among population with high risk of developing adult-onset Primary Open Angle Glaucoma.</p></sec><sec id="s10"><title>10. Conclusion</title><p>Mutations in myocilin gene are associated with adult-onset POAG in Rivers State. Its relevance as a biomarker for diagnosis of adult-onset POAG needs further investigations.</p></sec><sec id="s11"><title>Financial Support and Sponsorship</title><p>This work had financial support from Tertiary Education Trust Fund (TET Fund) Institution-Based Research Grant of the University of Port Harcourt, Nigeria.</p></sec><sec id="s12"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s13"><title>Cite this paper</title><p>Onua, A.A. and Pedro-Egbe, C.N. (2023) Prevalence of Myocilin Gene Mutation in Adult-Onset Primary Open Angle Glaucoma and Non- Glaucoma Subjects Who Are Indigenes of Rivers State, Nigeria. Open Journal of Ophthalmology, 13, 91-105. https://doi.org/10.4236/ojoph.2023.131010</p></sec></body><back><ref-list><title>References</title><ref id="scirp.123208-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2020) Magnitude and Cause of Visual Impairment. WHO Fact Sheet No. 282. WHO, Geneva. http://who.int/</mixed-citation></ref><ref id="scirp.123208-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Kyari, F., Gudlavalleti, M.V., Sivsubramaniam, S., Gilbert, C.E., Abdull, M.M., Entekume, G. and Foster, A. (2009) Prevalence of Blindness and Visual Impairment in Nigeria: The National Blindness and Visual Impairment Study. Investigative Ophthalmology &amp; Visual Science, 50, 2033-2039. https://doi.org/10.1167/iovs.08-3133</mixed-citation></ref><ref id="scirp.123208-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Ashaye, A. (2010) Glaucoma Blindness: Facts, Fancies and Fables. 12th Faculty Lecture, Faculty of Ophthalmology, National Postgraduate Medical College of Nigeria, Ibadan, 1-48.</mixed-citation></ref><ref id="scirp.123208-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Allingham, R.R., Liu, Y. and Rhee, D.J. (2009) The Genetics of Primary Open Angle Glaucoma: A Review. Experimental Eye Research, 88, 837-844. https://doi.org/10.1016/j.exer.2008.11.003</mixed-citation></ref><ref id="scirp.123208-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Bowling, B. (2016) Kanski’s Clinical Ophthalmology: A Systemic Approach. 8th Edition, Elsevier, Amsterdam, 306-366.</mixed-citation></ref><ref id="scirp.123208-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Fan, B.J. and Wiggs, J.L. (2010) Glaucoma: Genes, Phenotypes, and New Directions for Therapy. Journal of Clinical Investigation, 120, 3064-3072. https://doi.org/10.1172/JCI43085</mixed-citation></ref><ref id="scirp.123208-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Fingert, J.H., Robin, A.L., Stone, J.L., Roos, B., Davis, L.K., Scheetz, T.A., et al. (2011) Copy Number Variations on Chromosom 12q14 Patients with Normal Tension Glaucoma. Human Molecular Genetics, 20, 2482-2494. https://doi.org/10.1093/hmg/ddr123</mixed-citation></ref><ref id="scirp.123208-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Monemi, S., Spaeth, G., DaSilva, A., et al. (2005) Identification of a Novel Adult-Onset Primary Open-Angle Glaucoma (POAG) Gene on 5q22.1. Human Molecular Genetics, 14, 725-733. https://doi.org/10.1093/hmg/ddi068</mixed-citation></ref><ref id="scirp.123208-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Hauser, M.A., Akafo, S.K, Qin, X., Miura, S., Gibson, J.R., Allingham, R.R., et al. (2013) Investigation of Known Genetic Risk Factors for Primary Open Angle Glaucoma in Two Populations of African Ancestry. Investigative Ophthalmology &amp; Visual Science, 54, 6248-6254. https://doi.org/10.1167/iovs.13-12779</mixed-citation></ref><ref id="scirp.123208-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Stone, E.M., Aldave, A.J., Drack, A.V., et al. (2012) Recommendations for Genetic Testing of Inherited Eye Diseases: Report of the American Academy of Ophthalmology Task Force on Genetic Testing. Ophthalmology, 119, 2408-2410.https://doi.org/10.1016/j.ophtha.2012.05.047</mixed-citation></ref><ref id="scirp.123208-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Kwon, Y.H., Fingert, J.H., Kuehn, M.H. and Alward, W.L. (2009) Primary Open-Angle Glaucoma. New England Journal of Medicine, 360, 1113-1124. https://doi.org/10.1056/NEJMra0804630</mixed-citation></ref><ref id="scirp.123208-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Lwanga, S.K., Lemeshow, S. and WHO (1991) Sample Size Determination in Health Studies: A Practical Manual. World Health Organization, Geneva, 10-28.</mixed-citation></ref><ref id="scirp.123208-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">https://www.royalbiotech.com/</mixed-citation></ref><ref id="scirp.123208-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">GenBank Overview. https://www.ncbi.nlm.nih.gov/genbank/</mixed-citation></ref><ref id="scirp.123208-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">All Good Science Starts with Sample Collection. https://www.zymoresearch.com</mixed-citation></ref><ref id="scirp.123208-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Allen, K.F., Gaier, E.D. and Wiggs, J.L. (2015) Genetics of Primary Inherited Disorders of the Optic Nerve: Clinical Applications. Cold Spring Harbor Perspectives in Medicine, 5, Article ID: a017277. https://doi.org/10.1101/cshperspect.a017277</mixed-citation></ref><ref id="scirp.123208-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Kyari, F., Entekume, G., Rabiu, M., Spry, P., Wormald, R., Nolan, W., Murthy, G.V.S. and Gilbert, C.E. (2015) A Population-Based Survey of the Prevalence and Types of Glaucoma in Nigeria: Results from the Nigeria National Blindness and Visual Impairment Survey. BMC Ophthalmology, 15, Article No. 176. https://doi.org/10.1186/s12886-015-0160-6</mixed-citation></ref><ref id="scirp.123208-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Awoyesuku, E.A. and Ejimadu, C.S. (2012) Visual Disability in Newly Diagnosed Primary Open Angle Glaucoma (POAG) Patients in a Tertiary Hospital in Nigeria. Nigeria Journal of Medicine, 21, 78-80.</mixed-citation></ref><ref id="scirp.123208-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Murdoch, I.E., Cousens, S.N., Babalola, O.E., Yang, Y.F., Abiose, A. and Jones, B.R. (2001) Glaucoma Prevalence May Not Be Uniformly High in All Black Population. African Journal of Medicine and Medical Sciences, 30, 337-3379.</mixed-citation></ref><ref id="scirp.123208-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Adekoya, B.J., Shah, S.P., Onakoya, A.O. and Ayanniyi, A.A. (2014) Glaucoma in Southwest Nigeria: Clinical Presentation, Family History and Perceptions. International Ophthalmology, 34, 1027-1036. https://doi.org/10.1007/s10792-014-9903-2</mixed-citation></ref><ref id="scirp.123208-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Leske, M.C., Wu, S.-Y., Hennis, A., Honkanen, R. and Nemesure, B. (2008) Risk Factors for Incident Open-Angle Glaucoma: The Barbados Eye Studies. Ophthalmology, 115, 85-93. https://doi.org/10.1016/j.ophtha.2007.03.017</mixed-citation></ref><ref id="scirp.123208-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Challa, P., Herndon, L.W., Hauser, M.A., Broomer, B.W., Pericak-Vance, M.A., Ababio-Danso, B. and Allingham, R.R. (2002) Prevalence of Myocilin Mutations in Adults with Primary Open-angle Glaucoma in Ghana, West Africa. Journal of Glaucoma, 5, 416-420. https://doi.org/10.1097/00061198-200210000-00008</mixed-citation></ref><ref id="scirp.123208-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Fingert, J.H., Héon, E., Liebmann, J.M., Yamamoto, T., Craig, J.E., Rait, J., Kawase, K., Hoh, S.-T., Buys, Y.M., Dickinson, J., Hockey, R.R., Williams-Lyn, D., Trope, G., Kitazawa, Y., Ritch, R., Mackey, D.A., Alward, W.L.M., Sheffield, V.C. and Stone, E.M. (1999) Analysis of Myocilin Mutations in 1703 Glaucoma Patients from Five Different Populations. Human Molecular Genetics, 8, 899-905. https://doi.org/10.1093/hmg/8.5.899</mixed-citation></ref><ref id="scirp.123208-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Ennis, S., Gibson, J., Griffiths, H., Bunyan, D., Cree, A.J., Self, J., MacLeod, A. and Lotery, A. (2010) Prevalence of Myocilin Gene Mutations in a Novel UK Cohort of POAG Patients. Eye, 24, 328-333. https://doi.org/10.1038/eye.2009.73</mixed-citation></ref></ref-list></back></article>